FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629091_at:

>probe:Drosophila_2:1629091_at:239:387; Interrogation_Position=470; Antisense; GAAAAGGTCGTGTGCTCCGGTGCCT
>probe:Drosophila_2:1629091_at:507:109; Interrogation_Position=507; Antisense; AGAAGATCTCCGTGACCTATCACTA
>probe:Drosophila_2:1629091_at:174:147; Interrogation_Position=528; Antisense; ACTACAAGGGCGTCACCGACAAGTT
>probe:Drosophila_2:1629091_at:532:221; Interrogation_Position=578; Antisense; AAGGGACTGATCCAGGCCCATGGAT
>probe:Drosophila_2:1629091_at:508:65; Interrogation_Position=597; Antisense; ATGGATTCCAGCTGATCGAGACACC
>probe:Drosophila_2:1629091_at:49:205; Interrogation_Position=638; Antisense; AAGCCCCGCGTCAACTGGGACAAAG
>probe:Drosophila_2:1629091_at:367:285; Interrogation_Position=683; Antisense; CTGGAGAAGCAGTTCGACGCCGACT
>probe:Drosophila_2:1629091_at:226:143; Interrogation_Position=705; Antisense; ACTGGGCCAAGAACCTGAAGATCGT
>probe:Drosophila_2:1629091_at:715:137; Interrogation_Position=741; Antisense; ACGATACCACCGATGAGGATGCCAT
>probe:Drosophila_2:1629091_at:707:77; Interrogation_Position=756; Antisense; AGGATGCCATCAAGGTGCTGCACGG
>probe:Drosophila_2:1629091_at:541:147; Interrogation_Position=834; Antisense; ACTACCAGATCAAGACCGTCGAGGA
>probe:Drosophila_2:1629091_at:109:727; Interrogation_Position=861; Antisense; TTGGATATCTTCTGAAAGCCGTGCA
>probe:Drosophila_2:1629091_at:419:125; Interrogation_Position=877; Antisense; AGCCGTGCAGGCTTACTACGAGAAG
>probe:Drosophila_2:1629091_at:512:227; Interrogation_Position=908; Antisense; AAGGCCTAAGCCCAACGCTAGAGGA

Paste this into a BLAST search page for me
GAAAAGGTCGTGTGCTCCGGTGCCTAGAAGATCTCCGTGACCTATCACTAACTACAAGGGCGTCACCGACAAGTTAAGGGACTGATCCAGGCCCATGGATATGGATTCCAGCTGATCGAGACACCAAGCCCCGCGTCAACTGGGACAAAGCTGGAGAAGCAGTTCGACGCCGACTACTGGGCCAAGAACCTGAAGATCGTACGATACCACCGATGAGGATGCCATAGGATGCCATCAAGGTGCTGCACGGACTACCAGATCAAGACCGTCGAGGATTGGATATCTTCTGAAAGCCGTGCAAGCCGTGCAGGCTTACTACGAGAAGAAGGCCTAAGCCCAACGCTAGAGGA

Full Affymetrix probeset data:

Annotations for 1629091_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720