FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629093_at:

>probe:Drosophila_2:1629093_at:514:361; Interrogation_Position=1000; Antisense; GCAAGGAGATTCACCTGCACATCCA
>probe:Drosophila_2:1629093_at:5:319; Interrogation_Position=1053; Antisense; GCCGGTCAGGGCTATCAGTATGAAT
>probe:Drosophila_2:1629093_at:470:41; Interrogation_Position=1103; Antisense; ATCGGATCCCTATGGAGCCTATGCA
>probe:Drosophila_2:1629093_at:406:435; Interrogation_Position=1176; Antisense; GAGGTGCCCAACAATACGGATCCCA
>probe:Drosophila_2:1629093_at:491:423; Interrogation_Position=1229; Antisense; GAGACAACTCATCCGCTGAGCAAGA
>probe:Drosophila_2:1629093_at:559:421; Interrogation_Position=1246; Antisense; GAGCAAGAGCTGTTCCACATGATGG
>probe:Drosophila_2:1629093_at:131:415; Interrogation_Position=1292; Antisense; GACCACCGCGTTTAATTAGCTAGCA
>probe:Drosophila_2:1629093_at:30:677; Interrogation_Position=1312; Antisense; TAGCACACATTTAGTCAGCGACTTT
>probe:Drosophila_2:1629093_at:314:411; Interrogation_Position=1342; Antisense; GACGCAGCTTTACTTACACCTAAAA
>probe:Drosophila_2:1629093_at:132:91; Interrogation_Position=859; Antisense; AGTTCATTACCCTGAAGTCCAGTCT
>probe:Drosophila_2:1629093_at:250:153; Interrogation_Position=890; Antisense; ACAGTATGAGAACACGGCGCCGTCC
>probe:Drosophila_2:1629093_at:124:503; Interrogation_Position=911; Antisense; GTCCTTCAATTACCCGGGCTGGAAT
>probe:Drosophila_2:1629093_at:190:573; Interrogation_Position=927; Antisense; GGCTGGAATCCTCATGCCAAGGAGT
>probe:Drosophila_2:1629093_at:528:725; Interrogation_Position=969; Antisense; TTGAGTGGTCATGGCGCTGGTCATC

Paste this into a BLAST search page for me
GCAAGGAGATTCACCTGCACATCCAGCCGGTCAGGGCTATCAGTATGAATATCGGATCCCTATGGAGCCTATGCAGAGGTGCCCAACAATACGGATCCCAGAGACAACTCATCCGCTGAGCAAGAGAGCAAGAGCTGTTCCACATGATGGGACCACCGCGTTTAATTAGCTAGCATAGCACACATTTAGTCAGCGACTTTGACGCAGCTTTACTTACACCTAAAAAGTTCATTACCCTGAAGTCCAGTCTACAGTATGAGAACACGGCGCCGTCCGTCCTTCAATTACCCGGGCTGGAATGGCTGGAATCCTCATGCCAAGGAGTTTGAGTGGTCATGGCGCTGGTCATC

Full Affymetrix probeset data:

Annotations for 1629093_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720