FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629096_at:

>probe:Drosophila_2:1629096_at:131:717; Interrogation_Position=112; Antisense; TTCGGCGTCGTCTGCGGCTGGATAA
>probe:Drosophila_2:1629096_at:270:57; Interrogation_Position=136; Antisense; ATGAGCCTGATCACATTCGTTGTCT
>probe:Drosophila_2:1629096_at:78:589; Interrogation_Position=14; Antisense; TGGAGTATCAGCACTATTTGCAGAA
>probe:Drosophila_2:1629096_at:236:151; Interrogation_Position=148; Antisense; ACATTCGTTGTCTACAAGGCAGCAA
>probe:Drosophila_2:1629096_at:175:227; Interrogation_Position=163; Antisense; AAGGCAGCAATTGGCCTGGGCGCCA
>probe:Drosophila_2:1629096_at:295:255; Interrogation_Position=186; Antisense; CAAAGCCACGGCATGTGACAACGAT
>probe:Drosophila_2:1629096_at:638:443; Interrogation_Position=220; Antisense; GATGATCTCGACCTGGACATGCATG
>probe:Drosophila_2:1629096_at:179:485; Interrogation_Position=255; Antisense; GTATGACCGGATGTTGTCCCAGTGC
>probe:Drosophila_2:1629096_at:423:633; Interrogation_Position=271; Antisense; TCCCAGTGCCAGGACCTTAGTGATT
>probe:Drosophila_2:1629096_at:547:75; Interrogation_Position=281; Antisense; AGGACCTTAGTGATTGGCTTGTGAG
>probe:Drosophila_2:1629096_at:338:369; Interrogation_Position=36; Antisense; GAATGAGCTGACCATTTTCCACTAC
>probe:Drosophila_2:1629096_at:701:671; Interrogation_Position=58; Antisense; TACCACCTACTCTTCGACTATGGAG
>probe:Drosophila_2:1629096_at:379:681; Interrogation_Position=76; Antisense; TATGGAGCACCGATCCAGGTGGCCA
>probe:Drosophila_2:1629096_at:510:81; Interrogation_Position=92; Antisense; AGGTGGCCACTTGCATTGCCTTCGG

Paste this into a BLAST search page for me
TTCGGCGTCGTCTGCGGCTGGATAAATGAGCCTGATCACATTCGTTGTCTTGGAGTATCAGCACTATTTGCAGAAACATTCGTTGTCTACAAGGCAGCAAAAGGCAGCAATTGGCCTGGGCGCCACAAAGCCACGGCATGTGACAACGATGATGATCTCGACCTGGACATGCATGGTATGACCGGATGTTGTCCCAGTGCTCCCAGTGCCAGGACCTTAGTGATTAGGACCTTAGTGATTGGCTTGTGAGGAATGAGCTGACCATTTTCCACTACTACCACCTACTCTTCGACTATGGAGTATGGAGCACCGATCCAGGTGGCCAAGGTGGCCACTTGCATTGCCTTCGG

Full Affymetrix probeset data:

Annotations for 1629096_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720