FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629097_at:

>probe:Drosophila_2:1629097_at:366:677; Interrogation_Position=1503; Antisense; TAGGTGGTGCAGAGGCCACCCACTT
>probe:Drosophila_2:1629097_at:241:301; Interrogation_Position=1545; Antisense; CCCACAATGCGGCTAGTGCCATGAG
>probe:Drosophila_2:1629097_at:301:527; Interrogation_Position=1570; Antisense; GGGAATATTCGTGTGTGTCTAAGTA
>probe:Drosophila_2:1629097_at:546:491; Interrogation_Position=1669; Antisense; GTAAATTTATTCGTGTGCTCGCTCA
>probe:Drosophila_2:1629097_at:457:505; Interrogation_Position=1683; Antisense; GTGCTCGCTCACACTTAGGGAAGTG
>probe:Drosophila_2:1629097_at:138:317; Interrogation_Position=1748; Antisense; GCCTGACCAGGTAGTTGCATTGCAC
>probe:Drosophila_2:1629097_at:84:677; Interrogation_Position=1759; Antisense; TAGTTGCATTGCACTCGCACACATA
>probe:Drosophila_2:1629097_at:659:649; Interrogation_Position=1809; Antisense; TCACACTCACCTATTGAGCTCGGAT
>probe:Drosophila_2:1629097_at:240:419; Interrogation_Position=1824; Antisense; GAGCTCGGATCCAAAAATTATTTTT
>probe:Drosophila_2:1629097_at:285:21; Interrogation_Position=1873; Antisense; ATATCTTTGAGCTTGTTTGCAATTG
>probe:Drosophila_2:1629097_at:366:105; Interrogation_Position=1928; Antisense; AGAAGTAGTAATCATTCCCACCCTC
>probe:Drosophila_2:1629097_at:589:9; Interrogation_Position=1941; Antisense; ATTCCCACCCTCAAATGCTATTGTA
>probe:Drosophila_2:1629097_at:411:369; Interrogation_Position=1987; Antisense; GAATGATCTTTATTGTCTCTAAGTA
>probe:Drosophila_2:1629097_at:217:703; Interrogation_Position=2022; Antisense; TTATAGTCCTAGTTATGGTATGTCT

Paste this into a BLAST search page for me
TAGGTGGTGCAGAGGCCACCCACTTCCCACAATGCGGCTAGTGCCATGAGGGGAATATTCGTGTGTGTCTAAGTAGTAAATTTATTCGTGTGCTCGCTCAGTGCTCGCTCACACTTAGGGAAGTGGCCTGACCAGGTAGTTGCATTGCACTAGTTGCATTGCACTCGCACACATATCACACTCACCTATTGAGCTCGGATGAGCTCGGATCCAAAAATTATTTTTATATCTTTGAGCTTGTTTGCAATTGAGAAGTAGTAATCATTCCCACCCTCATTCCCACCCTCAAATGCTATTGTAGAATGATCTTTATTGTCTCTAAGTATTATAGTCCTAGTTATGGTATGTCT

Full Affymetrix probeset data:

Annotations for 1629097_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720