FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629098_at:

>probe:Drosophila_2:1629098_at:5:175; Interrogation_Position=192; Antisense; AAACGCCACAGTTCCGTATAGGATA
>probe:Drosophila_2:1629098_at:717:429; Interrogation_Position=223; Antisense; GAGTTTGATGCTCCTCATGTGGAAT
>probe:Drosophila_2:1629098_at:481:207; Interrogation_Position=253; Antisense; AAGCTTGGCATGCAATTCATCGAGT
>probe:Drosophila_2:1629098_at:146:275; Interrogation_Position=284; Antisense; CTTGTATTCGATTTGTGCCTGCTGA
>probe:Drosophila_2:1629098_at:523:191; Interrogation_Position=322; Antisense; AACTATCTTTTTGTGCTTCCGTCCA
>probe:Drosophila_2:1629098_at:118:505; Interrogation_Position=342; Antisense; GTCCACTTCAGGATGCAGCTCCAAA
>probe:Drosophila_2:1629098_at:488:383; Interrogation_Position=389; Antisense; GAACTGTCAAACTAAAGCCTGGCTC
>probe:Drosophila_2:1629098_at:144:581; Interrogation_Position=408; Antisense; TGGCTCATTGGATACAGGTTGCTTT
>probe:Drosophila_2:1629098_at:616:723; Interrogation_Position=426; Antisense; TTGCTTTAAGCTGGGCACCATCCAA
>probe:Drosophila_2:1629098_at:254:145; Interrogation_Position=466; Antisense; ACTTTGGGATTCCACCATCAGCAGT
>probe:Drosophila_2:1629098_at:69:87; Interrogation_Position=488; Antisense; AGTGCTCCCCGAATCGAGATGAGTT
>probe:Drosophila_2:1629098_at:112:107; Interrogation_Position=530; Antisense; AGAACATTTCCGAGGGTCACGAGAA
>probe:Drosophila_2:1629098_at:249:529; Interrogation_Position=587; Antisense; GGGATTTCGATCAGCCGTATGACTA
>probe:Drosophila_2:1629098_at:635:11; Interrogation_Position=619; Antisense; ATTCTACACTACAGTTCCTTGGCAT

Paste this into a BLAST search page for me
AAACGCCACAGTTCCGTATAGGATAGAGTTTGATGCTCCTCATGTGGAATAAGCTTGGCATGCAATTCATCGAGTCTTGTATTCGATTTGTGCCTGCTGAAACTATCTTTTTGTGCTTCCGTCCAGTCCACTTCAGGATGCAGCTCCAAAGAACTGTCAAACTAAAGCCTGGCTCTGGCTCATTGGATACAGGTTGCTTTTTGCTTTAAGCTGGGCACCATCCAAACTTTGGGATTCCACCATCAGCAGTAGTGCTCCCCGAATCGAGATGAGTTAGAACATTTCCGAGGGTCACGAGAAGGGATTTCGATCAGCCGTATGACTAATTCTACACTACAGTTCCTTGGCAT

Full Affymetrix probeset data:

Annotations for 1629098_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720