FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629099_at:

>probe:Drosophila_2:1629099_at:267:435; Interrogation_Position=163; Antisense; GAGGGAGCTGCATCCTTTGGATACG
>probe:Drosophila_2:1629099_at:654:589; Interrogation_Position=180; Antisense; TGGATACGGATACTACTCGTCACCC
>probe:Drosophila_2:1629099_at:135:27; Interrogation_Position=189; Antisense; ATACTACTCGTCACCCTACTTGGGT
>probe:Drosophila_2:1629099_at:61:667; Interrogation_Position=205; Antisense; TACTTGGGTGGCTACTACGGCGGAT
>probe:Drosophila_2:1629099_at:594:659; Interrogation_Position=217; Antisense; TACTACGGCGGATATTGGCCACATT
>probe:Drosophila_2:1629099_at:535:3; Interrogation_Position=230; Antisense; ATTGGCCACATTACAGCGGCAGTTA
>probe:Drosophila_2:1629099_at:605:329; Interrogation_Position=245; Antisense; GCGGCAGTTACTACGGAATTGGTTA
>probe:Drosophila_2:1629099_at:275:289; Interrogation_Position=258; Antisense; CGGAATTGGTTATCCATACTATGGA
>probe:Drosophila_2:1629099_at:630:587; Interrogation_Position=279; Antisense; TGGAGGTTACTACGGATTGCATCAT
>probe:Drosophila_2:1629099_at:363:465; Interrogation_Position=293; Antisense; GATTGCATCATCACCATGGGCACTA
>probe:Drosophila_2:1629099_at:579:261; Interrogation_Position=304; Antisense; CACCATGGGCACTATGGACACTACT
>probe:Drosophila_2:1629099_at:226:579; Interrogation_Position=60; Antisense; GGCCATGTTCTTTGTCGGATCTGAG
>probe:Drosophila_2:1629099_at:284:693; Interrogation_Position=70; Antisense; TTTGTCGGATCTGAGGCCCTGCCAC
>probe:Drosophila_2:1629099_at:60:629; Interrogation_Position=89; Antisense; TGCCACGCCCACAGGAGGGTCGTGA

Paste this into a BLAST search page for me
GAGGGAGCTGCATCCTTTGGATACGTGGATACGGATACTACTCGTCACCCATACTACTCGTCACCCTACTTGGGTTACTTGGGTGGCTACTACGGCGGATTACTACGGCGGATATTGGCCACATTATTGGCCACATTACAGCGGCAGTTAGCGGCAGTTACTACGGAATTGGTTACGGAATTGGTTATCCATACTATGGATGGAGGTTACTACGGATTGCATCATGATTGCATCATCACCATGGGCACTACACCATGGGCACTATGGACACTACTGGCCATGTTCTTTGTCGGATCTGAGTTTGTCGGATCTGAGGCCCTGCCACTGCCACGCCCACAGGAGGGTCGTGA

Full Affymetrix probeset data:

Annotations for 1629099_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720