FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629100_at:

>probe:Drosophila_2:1629100_at:83:305; Interrogation_Position=106; Antisense; CCTCATCGAAGCCTTGCCAAAAGAA
>probe:Drosophila_2:1629100_at:638:197; Interrogation_Position=174; Antisense; AACGTGATATCCACGGAGCCAGGCT
>probe:Drosophila_2:1629100_at:659:415; Interrogation_Position=189; Antisense; GAGCCAGGCTACTTCAACCAGGTGA
>probe:Drosophila_2:1629100_at:301:203; Interrogation_Position=204; Antisense; AACCAGGTGACCATCAGCCAGCCAT
>probe:Drosophila_2:1629100_at:206:115; Interrogation_Position=237; Antisense; AGCATGAGCCCCAGTTCAGTGTCAC
>probe:Drosophila_2:1629100_at:561:237; Interrogation_Position=271; Antisense; GAATAGTCACGTCTAGCACCTTGAG
>probe:Drosophila_2:1629100_at:645:271; Interrogation_Position=28; Antisense; CATCTTCGGCACTTCTACTTATTAT
>probe:Drosophila_2:1629100_at:699:723; Interrogation_Position=291; Antisense; TTGAGCTCCTGGGACGGCGAAGTCT
>probe:Drosophila_2:1629100_at:650:639; Interrogation_Position=313; Antisense; TCTGGTGGCCCAAAAGGGACTCCAT
>probe:Drosophila_2:1629100_at:704:527; Interrogation_Position=328; Antisense; GGGACTCCATCGAGGATTACTAATC
>probe:Drosophila_2:1629100_at:515:705; Interrogation_Position=375; Antisense; TTAGCGTATCGCTGCACTACATAAA
>probe:Drosophila_2:1629100_at:589:681; Interrogation_Position=436; Antisense; TATTTAATGAAACTACCGACTCTGT
>probe:Drosophila_2:1629100_at:244:131; Interrogation_Position=450; Antisense; ACCGACTCTGTTTTTAGTTCTCACA
>probe:Drosophila_2:1629100_at:57:165; Interrogation_Position=65; Antisense; AAATATGTGCTTTCTCTTCCCACTT

Paste this into a BLAST search page for me
CCTCATCGAAGCCTTGCCAAAAGAAAACGTGATATCCACGGAGCCAGGCTGAGCCAGGCTACTTCAACCAGGTGAAACCAGGTGACCATCAGCCAGCCATAGCATGAGCCCCAGTTCAGTGTCACGAATAGTCACGTCTAGCACCTTGAGCATCTTCGGCACTTCTACTTATTATTTGAGCTCCTGGGACGGCGAAGTCTTCTGGTGGCCCAAAAGGGACTCCATGGGACTCCATCGAGGATTACTAATCTTAGCGTATCGCTGCACTACATAAATATTTAATGAAACTACCGACTCTGTACCGACTCTGTTTTTAGTTCTCACAAAATATGTGCTTTCTCTTCCCACTT

Full Affymetrix probeset data:

Annotations for 1629100_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720