Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629104_at:

>probe:Drosophila_2:1629104_at:396:401; Interrogation_Position=2975; Antisense; GACATGGTCATTGCCTTGATCTTGG
>probe:Drosophila_2:1629104_at:209:453; Interrogation_Position=2992; Antisense; GATCTTGGCCTTCAATCAGCAATTT
>probe:Drosophila_2:1629104_at:55:111; Interrogation_Position=3054; Antisense; AGAATCTGCCATCCGCCAAAGTGTT
>probe:Drosophila_2:1629104_at:227:375; Interrogation_Position=3085; Antisense; GAAGTTGCTACTTTTGCTCAATCGA
>probe:Drosophila_2:1629104_at:448:703; Interrogation_Position=3174; Antisense; TTATCGACATATTCAGCCATCCGGA
>probe:Drosophila_2:1629104_at:278:27; Interrogation_Position=3198; Antisense; ATACGGCGGGCATGTTCTACACGAA
>probe:Drosophila_2:1629104_at:328:459; Interrogation_Position=3242; Antisense; GATATAGTGGTTCGCCAGCTATCCG
>probe:Drosophila_2:1629104_at:621:117; Interrogation_Position=3258; Antisense; AGCTATCCGATTTGGATGCCGGCAG
>probe:Drosophila_2:1629104_at:235:487; Interrogation_Position=3282; Antisense; GTACGACGCGACCATGCTACTTGGA
>probe:Drosophila_2:1629104_at:164:341; Interrogation_Position=3297; Antisense; GCTACTTGGAGCTTTGCCGACGCAT
>probe:Drosophila_2:1629104_at:264:347; Interrogation_Position=3318; Antisense; GCATCCTGCGCAATACGAACTATCA
>probe:Drosophila_2:1629104_at:359:421; Interrogation_Position=3344; Antisense; GAGCACCAGCATCGCAAGCATGATC
>probe:Drosophila_2:1629104_at:171:297; Interrogation_Position=3386; Antisense; CGCATCTTCTGCGAGGAGACCGAGT
>probe:Drosophila_2:1629104_at:436:199; Interrogation_Position=3449; Antisense; AACGAATTTCCGCAGCTGTTCAAGG

Paste this into a BLAST search page for me
GACATGGTCATTGCCTTGATCTTGGGATCTTGGCCTTCAATCAGCAATTTAGAATCTGCCATCCGCCAAAGTGTTGAAGTTGCTACTTTTGCTCAATCGATTATCGACATATTCAGCCATCCGGAATACGGCGGGCATGTTCTACACGAAGATATAGTGGTTCGCCAGCTATCCGAGCTATCCGATTTGGATGCCGGCAGGTACGACGCGACCATGCTACTTGGAGCTACTTGGAGCTTTGCCGACGCATGCATCCTGCGCAATACGAACTATCAGAGCACCAGCATCGCAAGCATGATCCGCATCTTCTGCGAGGAGACCGAGTAACGAATTTCCGCAGCTGTTCAAGG

Full Affymetrix probeset data:

Annotations for 1629104_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime