FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629105_at:

>probe:Drosophila_2:1629105_at:575:255; Interrogation_Position=147; Antisense; CAAATGCTGTAACGCGGCACTCTTA
>probe:Drosophila_2:1629105_at:640:145; Interrogation_Position=165; Antisense; ACTCTTAATCCTCGAGCAATCATTC
>probe:Drosophila_2:1629105_at:353:89; Interrogation_Position=17; Antisense; AGACCGGTAACTATTCCTTTGCAGG
>probe:Drosophila_2:1629105_at:579:597; Interrogation_Position=217; Antisense; TGTCTACCTGACCAAGAAGCTGCTC
>probe:Drosophila_2:1629105_at:126:493; Interrogation_Position=293; Antisense; GTAACTCGGGCCAATACACAACCAT
>probe:Drosophila_2:1629105_at:604:31; Interrogation_Position=316; Antisense; ATAATGAAACGGATGCCACTGCGCA
>probe:Drosophila_2:1629105_at:624:257; Interrogation_Position=332; Antisense; CACTGCGCATTGTGGATACTGGCAA
>probe:Drosophila_2:1629105_at:627:693; Interrogation_Position=34; Antisense; TTTGCAGGCACACTTATTCATCCGC
>probe:Drosophila_2:1629105_at:241:673; Interrogation_Position=368; Antisense; TAGCCTACGACGATGTTGGTGGACC
>probe:Drosophila_2:1629105_at:311:631; Interrogation_Position=414; Antisense; TCCCTCGGAAAATCGTTACCAGCTT
>probe:Drosophila_2:1629105_at:582:513; Interrogation_Position=451; Antisense; GTGTTCAGATTCTTCAAGGGACCAA
>probe:Drosophila_2:1629105_at:464:347; Interrogation_Position=479; Antisense; GCATGACCAACGTATCATCGATTCG
>probe:Drosophila_2:1629105_at:343:271; Interrogation_Position=52; Antisense; CATCCGCGGGTGGTTATGACTGTCA
>probe:Drosophila_2:1629105_at:389:55; Interrogation_Position=67; Antisense; ATGACTGTCACCTACCGGGTTGAAA

Paste this into a BLAST search page for me
CAAATGCTGTAACGCGGCACTCTTAACTCTTAATCCTCGAGCAATCATTCAGACCGGTAACTATTCCTTTGCAGGTGTCTACCTGACCAAGAAGCTGCTCGTAACTCGGGCCAATACACAACCATATAATGAAACGGATGCCACTGCGCACACTGCGCATTGTGGATACTGGCAATTTGCAGGCACACTTATTCATCCGCTAGCCTACGACGATGTTGGTGGACCTCCCTCGGAAAATCGTTACCAGCTTGTGTTCAGATTCTTCAAGGGACCAAGCATGACCAACGTATCATCGATTCGCATCCGCGGGTGGTTATGACTGTCAATGACTGTCACCTACCGGGTTGAAA

Full Affymetrix probeset data:

Annotations for 1629105_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720