FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629106_at:

>probe:Drosophila_2:1629106_at:360:635; Interrogation_Position=1048; Antisense; TCGCCCTTCTATCGCAGTGACTTAA
>probe:Drosophila_2:1629106_at:251:85; Interrogation_Position=1063; Antisense; AGTGACTTAAGCAATCTGTGCCCCT
>probe:Drosophila_2:1629106_at:281:63; Interrogation_Position=1090; Antisense; ATGTGCAACCAAGTGTCCTGGCTGA
>probe:Drosophila_2:1629106_at:488:91; Interrogation_Position=1142; Antisense; AGTTTCCCGCCTTTGGAATGGTGCA
>probe:Drosophila_2:1629106_at:607:631; Interrogation_Position=1209; Antisense; TCCCGGTCCCTTTGAGAATGAAAAT
>probe:Drosophila_2:1629106_at:317:559; Interrogation_Position=1247; Antisense; GGACAACCGAGGCTACCACAATATA
>probe:Drosophila_2:1629106_at:321:699; Interrogation_Position=1283; Antisense; TTATATTATCCCTCTGTTCCAACAA
>probe:Drosophila_2:1629106_at:97:65; Interrogation_Position=1310; Antisense; ATGGGACTCTTTGTGTACATGCAAT
>probe:Drosophila_2:1629106_at:60:151; Interrogation_Position=1383; Antisense; ACTTGTCTATATAATCAGCCCGTAT
>probe:Drosophila_2:1629106_at:41:321; Interrogation_Position=1400; Antisense; GCCCGTATTGCTTTGTATCCGTATA
>probe:Drosophila_2:1629106_at:403:471; Interrogation_Position=894; Antisense; GTTCGCCGGGCAATCATGCAACGGA
>probe:Drosophila_2:1629106_at:465:561; Interrogation_Position=916; Antisense; GGAAGCCGATCGCTCAACATTGAAC
>probe:Drosophila_2:1629106_at:525:465; Interrogation_Position=942; Antisense; GATTGGTGGCAAATTCCTGCCCATT
>probe:Drosophila_2:1629106_at:110:523; Interrogation_Position=980; Antisense; GGGCCCATGTTCACGCTGTGGAAAA

Paste this into a BLAST search page for me
TCGCCCTTCTATCGCAGTGACTTAAAGTGACTTAAGCAATCTGTGCCCCTATGTGCAACCAAGTGTCCTGGCTGAAGTTTCCCGCCTTTGGAATGGTGCATCCCGGTCCCTTTGAGAATGAAAATGGACAACCGAGGCTACCACAATATATTATATTATCCCTCTGTTCCAACAAATGGGACTCTTTGTGTACATGCAATACTTGTCTATATAATCAGCCCGTATGCCCGTATTGCTTTGTATCCGTATAGTTCGCCGGGCAATCATGCAACGGAGGAAGCCGATCGCTCAACATTGAACGATTGGTGGCAAATTCCTGCCCATTGGGCCCATGTTCACGCTGTGGAAAA

Full Affymetrix probeset data:

Annotations for 1629106_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720