FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629107_at:

>probe:Drosophila_2:1629107_at:457:119; Interrogation_Position=398; Antisense; AGCTGTTCCGTCTGAGGCAGATCAA
>probe:Drosophila_2:1629107_at:639:185; Interrogation_Position=421; Antisense; AACAACGGTGTGTTCATCAAGCTGA
>probe:Drosophila_2:1629107_at:535:503; Interrogation_Position=513; Antisense; GTCCGTGCGGGAGCTGATCTACAAG
>probe:Drosophila_2:1629107_at:371:463; Interrogation_Position=542; Antisense; GATTCGTGAAGCATAACCGCCAGCG
>probe:Drosophila_2:1629107_at:507:505; Interrogation_Position=568; Antisense; GTGCCCATCACCGATAACTTCGTGA
>probe:Drosophila_2:1629107_at:550:623; Interrogation_Position=605; Antisense; TGCGTCAGGCGCACCAAATTCAGTG
>probe:Drosophila_2:1629107_at:221:87; Interrogation_Position=626; Antisense; AGTGCGTCGAGGATCTTGTCCATGA
>probe:Drosophila_2:1629107_at:457:727; Interrogation_Position=641; Antisense; TTGTCCATGAGATCTTCACCGTGGG
>probe:Drosophila_2:1629107_at:188:109; Interrogation_Position=737; Antisense; AGAAGGCCAACCATTATGTCAACGG
>probe:Drosophila_2:1629107_at:271:595; Interrogation_Position=753; Antisense; TGTCAACGGTGGTGACTTCGGCAAC
>probe:Drosophila_2:1629107_at:606:33; Interrogation_Position=790; Antisense; ATCAACCGTCTGCTGCGCAAGATGG
>probe:Drosophila_2:1629107_at:279:199; Interrogation_Position=845; Antisense; AACGACAACTGCAGCGGTTCGATGT
>probe:Drosophila_2:1629107_at:534:175; Interrogation_Position=928; Antisense; AAACGCAGTGTTTTCGCTTCGATTC
>probe:Drosophila_2:1629107_at:556:295; Interrogation_Position=942; Antisense; CGCTTCGATTCGCTGATTTAGTCAT

Paste this into a BLAST search page for me
AGCTGTTCCGTCTGAGGCAGATCAAAACAACGGTGTGTTCATCAAGCTGAGTCCGTGCGGGAGCTGATCTACAAGGATTCGTGAAGCATAACCGCCAGCGGTGCCCATCACCGATAACTTCGTGATGCGTCAGGCGCACCAAATTCAGTGAGTGCGTCGAGGATCTTGTCCATGATTGTCCATGAGATCTTCACCGTGGGAGAAGGCCAACCATTATGTCAACGGTGTCAACGGTGGTGACTTCGGCAACATCAACCGTCTGCTGCGCAAGATGGAACGACAACTGCAGCGGTTCGATGTAAACGCAGTGTTTTCGCTTCGATTCCGCTTCGATTCGCTGATTTAGTCAT

Full Affymetrix probeset data:

Annotations for 1629107_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720