Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629109_at:

>probe:Drosophila_2:1629109_at:711:21; Interrogation_Position=1516; Antisense; ATATGACCATCGTTAGCACTAATTG
>probe:Drosophila_2:1629109_at:372:243; Interrogation_Position=1536; Antisense; AATTGTAAGCCCTCAAGGACCACAG
>probe:Drosophila_2:1629109_at:719:553; Interrogation_Position=1552; Antisense; GGACCACAGAATACCTTTGTCATGG
>probe:Drosophila_2:1629109_at:411:373; Interrogation_Position=1587; Antisense; GAAGTTTTGCGATATATCAGCCTAT
>probe:Drosophila_2:1629109_at:555:139; Interrogation_Position=1746; Antisense; ACGGTTTATTATTCACGGACGACAT
>probe:Drosophila_2:1629109_at:19:557; Interrogation_Position=1762; Antisense; GGACGACATTGCTATTCTTTTGACC
>probe:Drosophila_2:1629109_at:622:713; Interrogation_Position=1776; Antisense; TTCTTTTGACCGCATGTGTACCACA
>probe:Drosophila_2:1629109_at:199:367; Interrogation_Position=1809; Antisense; GAATCACTGGGTTACATGACACTTA
>probe:Drosophila_2:1629109_at:543:505; Interrogation_Position=1882; Antisense; GTGCCCACAAATTCATACGTTACAT
>probe:Drosophila_2:1629109_at:419:139; Interrogation_Position=1898; Antisense; ACGTTACATCAGAAGGTTGCGGCAT
>probe:Drosophila_2:1629109_at:138:131; Interrogation_Position=1996; Antisense; ACCTATATGCGCCTTTAACCAGTGT
>probe:Drosophila_2:1629109_at:628:209; Interrogation_Position=2021; Antisense; AAGCACACCCCGATTCTAGAAGATA
>probe:Drosophila_2:1629109_at:199:33; Interrogation_Position=2043; Antisense; ATAAGTAGGGTTTTCCAGTTGCTGT
>probe:Drosophila_2:1629109_at:120:265; Interrogation_Position=2058; Antisense; CAGTTGCTGTAGTTGGTAGTCCATT

Paste this into a BLAST search page for me
ATATGACCATCGTTAGCACTAATTGAATTGTAAGCCCTCAAGGACCACAGGGACCACAGAATACCTTTGTCATGGGAAGTTTTGCGATATATCAGCCTATACGGTTTATTATTCACGGACGACATGGACGACATTGCTATTCTTTTGACCTTCTTTTGACCGCATGTGTACCACAGAATCACTGGGTTACATGACACTTAGTGCCCACAAATTCATACGTTACATACGTTACATCAGAAGGTTGCGGCATACCTATATGCGCCTTTAACCAGTGTAAGCACACCCCGATTCTAGAAGATAATAAGTAGGGTTTTCCAGTTGCTGTCAGTTGCTGTAGTTGGTAGTCCATT

Full Affymetrix probeset data:

Annotations for 1629109_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime