Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629110_x_at:

>probe:Drosophila_2:1629110_x_at:45:651; Interrogation_Position=102; Antisense; TCAGCTCCAACTGCGGCACGTGAAG
>probe:Drosophila_2:1629110_x_at:664:385; Interrogation_Position=141; Antisense; GAAAATTCACAAGGACCCGGTGGCA
>probe:Drosophila_2:1629110_x_at:11:247; Interrogation_Position=144; Antisense; AATTCACAAGGACCCGGTGGCAGAA
>probe:Drosophila_2:1629110_x_at:382:251; Interrogation_Position=150; Antisense; CAAGGACCCGGTGGCAGAAGAAGAA
>probe:Drosophila_2:1629110_x_at:519:61; Interrogation_Position=188; Antisense; AGGAGGAACCCCTGGTCAGGCCATA
>probe:Drosophila_2:1629110_x_at:683:547; Interrogation_Position=189; Antisense; GGAGGAACCCCTGGTCAGGCCATAA
>probe:Drosophila_2:1629110_x_at:2:183; Interrogation_Position=40; Antisense; AAAAGCTGCTGCTGCGGACCCCAGA
>probe:Drosophila_2:1629110_x_at:630:173; Interrogation_Position=41; Antisense; AAAGCTGCTGCTGCGGACCCCAGAG
>probe:Drosophila_2:1629110_x_at:550:621; Interrogation_Position=46; Antisense; TGCTGCTGCGGACCCCAGAGATTAG
>probe:Drosophila_2:1629110_x_at:378:621; Interrogation_Position=49; Antisense; TGCTGCGGACCCCAGAGATTAGCCT
>probe:Drosophila_2:1629110_x_at:109:413; Interrogation_Position=56; Antisense; GACCCCAGAGATTAGCCTCCAATGG
>probe:Drosophila_2:1629110_x_at:452:125; Interrogation_Position=69; Antisense; AGCCTCCAATGGAGGAGCCGTGCTC
>probe:Drosophila_2:1629110_x_at:130:435; Interrogation_Position=80; Antisense; GAGGAGCCGTGCTCCGGTTGCTTCA
>probe:Drosophila_2:1629110_x_at:431:507; Interrogation_Position=88; Antisense; GTGCTCCGGTTGCTTCAGCTCCAAC

Paste this into a BLAST search page for me
TCAGCTCCAACTGCGGCACGTGAAGGAAAATTCACAAGGACCCGGTGGCAAATTCACAAGGACCCGGTGGCAGAACAAGGACCCGGTGGCAGAAGAAGAAAGGAGGAACCCCTGGTCAGGCCATAGGAGGAACCCCTGGTCAGGCCATAAAAAAGCTGCTGCTGCGGACCCCAGAAAAGCTGCTGCTGCGGACCCCAGAGTGCTGCTGCGGACCCCAGAGATTAGTGCTGCGGACCCCAGAGATTAGCCTGACCCCAGAGATTAGCCTCCAATGGAGCCTCCAATGGAGGAGCCGTGCTCGAGGAGCCGTGCTCCGGTTGCTTCAGTGCTCCGGTTGCTTCAGCTCCAAC

Full Affymetrix probeset data:

Annotations for 1629110_x_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime