Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629111_at:

>probe:Drosophila_2:1629111_at:300:521; Interrogation_Position=4390; Antisense; GTGGCAGTTCAGAACCGGCTTTAGC
>probe:Drosophila_2:1629111_at:675:341; Interrogation_Position=4407; Antisense; GCTTTAGCGGGAACATCATCTTCGA
>probe:Drosophila_2:1629111_at:403:689; Interrogation_Position=4432; Antisense; TATTAGGACCTATTGCCAGCTCTAC
>probe:Drosophila_2:1629111_at:318:643; Interrogation_Position=4452; Antisense; TCTACTGGACTGACGGAGCCGGAAG
>probe:Drosophila_2:1629111_at:352:317; Interrogation_Position=4490; Antisense; GCCTCCTTCGCAGTCTGGCAATGAA
>probe:Drosophila_2:1629111_at:294:565; Interrogation_Position=4506; Antisense; GGCAATGAAGGACTGCTCAATCTTA
>probe:Drosophila_2:1629111_at:335:249; Interrogation_Position=4523; Antisense; CAATCTTAGCAGCACGGCGGGTACA
>probe:Drosophila_2:1629111_at:612:57; Interrogation_Position=4567; Antisense; ATGAGGAGCTTTTGGCTAGCCTGGC
>probe:Drosophila_2:1629111_at:515:339; Interrogation_Position=4581; Antisense; GCTAGCCTGGCTGGCGAATGACAGA
>probe:Drosophila_2:1629111_at:124:213; Interrogation_Position=4609; Antisense; AAGACAGCCGTCATGAGATATTCCT
>probe:Drosophila_2:1629111_at:163:97; Interrogation_Position=4624; Antisense; AGATATTCCTGTTGCTCTATGCGAT
>probe:Drosophila_2:1629111_at:698:681; Interrogation_Position=4641; Antisense; TATGCGATTTTCTCTTAAAGCTAGC
>probe:Drosophila_2:1629111_at:612:427; Interrogation_Position=4836; Antisense; GAGATTATTCCCGATTCTGTTAAGT
>probe:Drosophila_2:1629111_at:211:497; Interrogation_Position=4859; Antisense; GTCGATCAAACCGAAATCACCTTAT

Paste this into a BLAST search page for me
GTGGCAGTTCAGAACCGGCTTTAGCGCTTTAGCGGGAACATCATCTTCGATATTAGGACCTATTGCCAGCTCTACTCTACTGGACTGACGGAGCCGGAAGGCCTCCTTCGCAGTCTGGCAATGAAGGCAATGAAGGACTGCTCAATCTTACAATCTTAGCAGCACGGCGGGTACAATGAGGAGCTTTTGGCTAGCCTGGCGCTAGCCTGGCTGGCGAATGACAGAAAGACAGCCGTCATGAGATATTCCTAGATATTCCTGTTGCTCTATGCGATTATGCGATTTTCTCTTAAAGCTAGCGAGATTATTCCCGATTCTGTTAAGTGTCGATCAAACCGAAATCACCTTAT

Full Affymetrix probeset data:

Annotations for 1629111_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime