Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629112_at:

>probe:Drosophila_2:1629112_at:319:293; Interrogation_Position=1005; Antisense; CGTATTCTACCTATCCGACATGGAT
>probe:Drosophila_2:1629112_at:330:355; Interrogation_Position=1073; Antisense; GCACTGTGACCAATCCCTTTATGAT
>probe:Drosophila_2:1629112_at:507:419; Interrogation_Position=1100; Antisense; GAGCTATCTCTGTGTTTATCGGCAT
>probe:Drosophila_2:1629112_at:606:41; Interrogation_Position=1117; Antisense; ATCGGCATTCTGTTGGCGTCATATA
>probe:Drosophila_2:1629112_at:187:85; Interrogation_Position=631; Antisense; AGTGTGCCAGCCTATCTGAAACTAA
>probe:Drosophila_2:1629112_at:202:539; Interrogation_Position=662; Antisense; GGTTTGATTTCACGGAACTCTCCAC
>probe:Drosophila_2:1629112_at:453:333; Interrogation_Position=687; Antisense; GCTGGTGGCGTTCATGGCCATATTA
>probe:Drosophila_2:1629112_at:262:569; Interrogation_Position=712; Antisense; GGCATTTCGATAAACGTGACCTTGG
>probe:Drosophila_2:1629112_at:549:337; Interrogation_Position=786; Antisense; GCTCCTGGAACTGTTGCAACTCATA
>probe:Drosophila_2:1629112_at:109:193; Interrogation_Position=803; Antisense; AACTCATACTCTTCGCCATAGGATA
>probe:Drosophila_2:1629112_at:112:231; Interrogation_Position=856; Antisense; AATGTAGCTGCCCTGAGTTCCATCA
>probe:Drosophila_2:1629112_at:307:139; Interrogation_Position=902; Antisense; ACGTATCCCTCTACACGGATGTTGA
>probe:Drosophila_2:1629112_at:268:5; Interrogation_Position=969; Antisense; ATTGTGTAGTGGACTTGGACCCGCT
>probe:Drosophila_2:1629112_at:166:299; Interrogation_Position=990; Antisense; CGCTCTGTTCGGTATCGTATTCTAC

Paste this into a BLAST search page for me
CGTATTCTACCTATCCGACATGGATGCACTGTGACCAATCCCTTTATGATGAGCTATCTCTGTGTTTATCGGCATATCGGCATTCTGTTGGCGTCATATAAGTGTGCCAGCCTATCTGAAACTAAGGTTTGATTTCACGGAACTCTCCACGCTGGTGGCGTTCATGGCCATATTAGGCATTTCGATAAACGTGACCTTGGGCTCCTGGAACTGTTGCAACTCATAAACTCATACTCTTCGCCATAGGATAAATGTAGCTGCCCTGAGTTCCATCAACGTATCCCTCTACACGGATGTTGAATTGTGTAGTGGACTTGGACCCGCTCGCTCTGTTCGGTATCGTATTCTAC

Full Affymetrix probeset data:

Annotations for 1629112_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime