FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629116_at:

>probe:Drosophila_2:1629116_at:564:149; Interrogation_Position=234; Antisense; ACATTTTGCATTTTCTGGGCTGTCC
>probe:Drosophila_2:1629116_at:663:337; Interrogation_Position=259; Antisense; GCTAATTCCGCAGGCCCAAATGAAG
>probe:Drosophila_2:1629116_at:152:171; Interrogation_Position=296; Antisense; AAAGTGTCGCGTGCCCATGATGAGC
>probe:Drosophila_2:1629116_at:634:19; Interrogation_Position=327; Antisense; ATTTGCGCCGTTTGATCATCGATTT
>probe:Drosophila_2:1629116_at:576:291; Interrogation_Position=346; Antisense; CGATTTGGATGCCTTGGATCAGCTT
>probe:Drosophila_2:1629116_at:265:379; Interrogation_Position=416; Antisense; GAAGCCGTCTCATCATCGAGCGAAG
>probe:Drosophila_2:1629116_at:531:725; Interrogation_Position=459; Antisense; TTGAGACTACGATGGACTCCACGAA
>probe:Drosophila_2:1629116_at:701:623; Interrogation_Position=476; Antisense; TCCACGAAACCGGAGCTTGGGCTAT
>probe:Drosophila_2:1629116_at:481:273; Interrogation_Position=491; Antisense; CTTGGGCTATGTACACCGATGTCAT
>probe:Drosophila_2:1629116_at:492:303; Interrogation_Position=506; Antisense; CCGATGTCATCGCTCAAGGATTCAA
>probe:Drosophila_2:1629116_at:104:367; Interrogation_Position=561; Antisense; GAATCACATTTGTCGTTGAGCCTTT
>probe:Drosophila_2:1629116_at:603:543; Interrogation_Position=596; Antisense; GGATACATATCTTTGGCAACTGCAT
>probe:Drosophila_2:1629116_at:683:439; Interrogation_Position=674; Antisense; GATGTAACCTCGACTTTTTATCAAG
>probe:Drosophila_2:1629116_at:434:515; Interrogation_Position=719; Antisense; GTGTACATGCCATACTTATCCATTA

Paste this into a BLAST search page for me
ACATTTTGCATTTTCTGGGCTGTCCGCTAATTCCGCAGGCCCAAATGAAGAAAGTGTCGCGTGCCCATGATGAGCATTTGCGCCGTTTGATCATCGATTTCGATTTGGATGCCTTGGATCAGCTTGAAGCCGTCTCATCATCGAGCGAAGTTGAGACTACGATGGACTCCACGAATCCACGAAACCGGAGCTTGGGCTATCTTGGGCTATGTACACCGATGTCATCCGATGTCATCGCTCAAGGATTCAAGAATCACATTTGTCGTTGAGCCTTTGGATACATATCTTTGGCAACTGCATGATGTAACCTCGACTTTTTATCAAGGTGTACATGCCATACTTATCCATTA

Full Affymetrix probeset data:

Annotations for 1629116_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720