FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629117_at:

>probe:Drosophila_2:1629117_at:171:131; Interrogation_Position=2892; Antisense; ACCTCGTGTGTGTGTGTCCTTGCGT
>probe:Drosophila_2:1629117_at:290:515; Interrogation_Position=2905; Antisense; GTGTCCTTGCGTATGAGTGAGAGAA
>probe:Drosophila_2:1629117_at:160:401; Interrogation_Position=3033; Antisense; GACAGGGCCGCAGATTGTTTTGCTT
>probe:Drosophila_2:1629117_at:42:477; Interrogation_Position=3049; Antisense; GTTTTGCTTTATGATTGCCAACTGA
>probe:Drosophila_2:1629117_at:168:279; Interrogation_Position=3087; Antisense; CTAACCTTAGTCTATACTCCTGCAA
>probe:Drosophila_2:1629117_at:20:687; Interrogation_Position=3099; Antisense; TATACTCCTGCAAGTCCAACTAATC
>probe:Drosophila_2:1629117_at:54:677; Interrogation_Position=3125; Antisense; TAGCTTAGTTTCAACGCTGCCACAT
>probe:Drosophila_2:1629117_at:174:627; Interrogation_Position=3142; Antisense; TGCCACATTCCAATCTAATCCATTA
>probe:Drosophila_2:1629117_at:727:45; Interrogation_Position=3195; Antisense; ATCCGAACCGAACCAATCGAGTCTG
>probe:Drosophila_2:1629117_at:580:43; Interrogation_Position=3210; Antisense; ATCGAGTCTGCAGCGAAGCTCGGCT
>probe:Drosophila_2:1629117_at:695:337; Interrogation_Position=3232; Antisense; GCTCTCTTACTACTAATCCCATTAT
>probe:Drosophila_2:1629117_at:614:457; Interrogation_Position=3273; Antisense; GATTTTCGTAAAGCTCTCTGTACCA
>probe:Drosophila_2:1629117_at:1:641; Interrogation_Position=3289; Antisense; TCTGTACCAGGTAGTCGTAATCGTA
>probe:Drosophila_2:1629117_at:157:451; Interrogation_Position=3317; Antisense; GATCGTTGCAAGTGCTTCGGGAGTT

Paste this into a BLAST search page for me
ACCTCGTGTGTGTGTGTCCTTGCGTGTGTCCTTGCGTATGAGTGAGAGAAGACAGGGCCGCAGATTGTTTTGCTTGTTTTGCTTTATGATTGCCAACTGACTAACCTTAGTCTATACTCCTGCAATATACTCCTGCAAGTCCAACTAATCTAGCTTAGTTTCAACGCTGCCACATTGCCACATTCCAATCTAATCCATTAATCCGAACCGAACCAATCGAGTCTGATCGAGTCTGCAGCGAAGCTCGGCTGCTCTCTTACTACTAATCCCATTATGATTTTCGTAAAGCTCTCTGTACCATCTGTACCAGGTAGTCGTAATCGTAGATCGTTGCAAGTGCTTCGGGAGTT

Full Affymetrix probeset data:

Annotations for 1629117_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720