FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629118_at:

>probe:Drosophila_2:1629118_at:572:65; Interrogation_Position=13; Antisense; ATGGCAAACAAAGCTCTCATCCTTC
>probe:Drosophila_2:1629118_at:513:253; Interrogation_Position=135; Antisense; CAACTACCTGAGCTACGCCGTGATC
>probe:Drosophila_2:1629118_at:587:605; Interrogation_Position=155; Antisense; TGATCCACCACACCGCTGGAAACTA
>probe:Drosophila_2:1629118_at:347:119; Interrogation_Position=209; Antisense; AGCTGCAGAACATCCAGGCCTACCA
>probe:Drosophila_2:1629118_at:242:287; Interrogation_Position=309; Antisense; CGGCTGGAACGTTATGGGTGCTCAC
>probe:Drosophila_2:1629118_at:30:533; Interrogation_Position=324; Antisense; GGGTGCTCACGCCACTAACTGGAAC
>probe:Drosophila_2:1629118_at:562:585; Interrogation_Position=343; Antisense; TGGAACTCCAAGTCTATCGGCATCT
>probe:Drosophila_2:1629118_at:498:649; Interrogation_Position=408; Antisense; TCAGATCACCGCTGCCAAGGGTCTG
>probe:Drosophila_2:1629118_at:245:223; Interrogation_Position=424; Antisense; AAGGGTCTGCTCTCCGATGCGGTCA
>probe:Drosophila_2:1629118_at:666:331; Interrogation_Position=452; Antisense; GCGGCCAGATCGTTTCCGGATACAT
>probe:Drosophila_2:1629118_at:262:455; Interrogation_Position=470; Antisense; GATACATCCTGTACGGACATCGGCA
>probe:Drosophila_2:1629118_at:140:665; Interrogation_Position=481; Antisense; TACGGACATCGGCAGGTCGGCTCCA
>probe:Drosophila_2:1629118_at:215:47; Interrogation_Position=538; Antisense; ATCCGCACCTGGTCCAACTGGAAGG
>probe:Drosophila_2:1629118_at:501:329; Interrogation_Position=71; Antisense; GCGTGACCATCATCTCCAAGTCGGA

Paste this into a BLAST search page for me
ATGGCAAACAAAGCTCTCATCCTTCCAACTACCTGAGCTACGCCGTGATCTGATCCACCACACCGCTGGAAACTAAGCTGCAGAACATCCAGGCCTACCACGGCTGGAACGTTATGGGTGCTCACGGGTGCTCACGCCACTAACTGGAACTGGAACTCCAAGTCTATCGGCATCTTCAGATCACCGCTGCCAAGGGTCTGAAGGGTCTGCTCTCCGATGCGGTCAGCGGCCAGATCGTTTCCGGATACATGATACATCCTGTACGGACATCGGCATACGGACATCGGCAGGTCGGCTCCAATCCGCACCTGGTCCAACTGGAAGGGCGTGACCATCATCTCCAAGTCGGA

Full Affymetrix probeset data:

Annotations for 1629118_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720