FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629119_at:

>probe:Drosophila_2:1629119_at:21:177; Interrogation_Position=1081; Antisense; AAACGTTACTTCAAATCCACCAGCT
>probe:Drosophila_2:1629119_at:234:167; Interrogation_Position=1093; Antisense; AAATCCACCAGCTATCTTTTGGTAC
>probe:Drosophila_2:1629119_at:264:263; Interrogation_Position=1101; Antisense; CAGCTATCTTTTGGTACATCGAAAA
>probe:Drosophila_2:1629119_at:213:171; Interrogation_Position=1150; Antisense; AAAGTGGTCGCCGTATTTAGCAGAC
>probe:Drosophila_2:1629119_at:542:687; Interrogation_Position=1163; Antisense; TATTTAGCAGACACAACGGGTTGCC
>probe:Drosophila_2:1629119_at:635:469; Interrogation_Position=1182; Antisense; GTTGCCCAATGGAATAAGTGATCAC
>probe:Drosophila_2:1629119_at:708:657; Interrogation_Position=1196; Antisense; TAAGTGATCACAGACGTTGCTCAGT
>probe:Drosophila_2:1629119_at:125:637; Interrogation_Position=1280; Antisense; TCGGCCATTATAGACGGCTGTCCAA
>probe:Drosophila_2:1629119_at:477:139; Interrogation_Position=1293; Antisense; ACGGCTGTCCAAGGCCCTCGAGAAG
>probe:Drosophila_2:1629119_at:47:463; Interrogation_Position=730; Antisense; GATTCCAAAGAATTTCTCACCTACG
>probe:Drosophila_2:1629119_at:30:13; Interrogation_Position=768; Antisense; ATTCAAATTTCCCAACGACATGCTG
>probe:Drosophila_2:1629119_at:218:245; Interrogation_Position=773; Antisense; AATTTCCCAACGACATGCTGGAGTG
>probe:Drosophila_2:1629119_at:618:289; Interrogation_Position=895; Antisense; CGTGTGGACCACAAGAAACTATTGA
>probe:Drosophila_2:1629119_at:81:193; Interrogation_Position=911; Antisense; AACTATTGAAGCGTCACAGTCTGAG

Paste this into a BLAST search page for me
AAACGTTACTTCAAATCCACCAGCTAAATCCACCAGCTATCTTTTGGTACCAGCTATCTTTTGGTACATCGAAAAAAAGTGGTCGCCGTATTTAGCAGACTATTTAGCAGACACAACGGGTTGCCGTTGCCCAATGGAATAAGTGATCACTAAGTGATCACAGACGTTGCTCAGTTCGGCCATTATAGACGGCTGTCCAAACGGCTGTCCAAGGCCCTCGAGAAGGATTCCAAAGAATTTCTCACCTACGATTCAAATTTCCCAACGACATGCTGAATTTCCCAACGACATGCTGGAGTGCGTGTGGACCACAAGAAACTATTGAAACTATTGAAGCGTCACAGTCTGAG

Full Affymetrix probeset data:

Annotations for 1629119_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720