FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629120_at:

>probe:Drosophila_2:1629120_at:235:339; Interrogation_Position=208; Antisense; GCTCTCGTTGAGCAGCAGTACTCCA
>probe:Drosophila_2:1629120_at:472:695; Interrogation_Position=251; Antisense; TTTCCCGCAGCGATCTCAACTATAT
>probe:Drosophila_2:1629120_at:57:653; Interrogation_Position=266; Antisense; TCAACTATATTCAGGCGGCGACACA
>probe:Drosophila_2:1629120_at:541:575; Interrogation_Position=282; Antisense; GGCGACACATCCGAAGAATCTACAG
>probe:Drosophila_2:1629120_at:129:55; Interrogation_Position=386; Antisense; ATGACAGCGGACCAAGCAGTGCGCC
>probe:Drosophila_2:1629120_at:173:321; Interrogation_Position=408; Antisense; GCCCGCAAGCAGTACACTTGGTTCA
>probe:Drosophila_2:1629120_at:32:475; Interrogation_Position=428; Antisense; GTTCAAGCAGTACCGGTCCGCGTAT
>probe:Drosophila_2:1629120_at:657:461; Interrogation_Position=490; Antisense; GATTCGATTTCATTGCCAGCAGCAG
>probe:Drosophila_2:1629120_at:22:321; Interrogation_Position=516; Antisense; GCCGCTAACAGCAGCTACTACAAGT
>probe:Drosophila_2:1629120_at:273:223; Interrogation_Position=566; Antisense; AAGGGAGCGATACGCCGCATAGCCA
>probe:Drosophila_2:1629120_at:508:663; Interrogation_Position=615; Antisense; TACAATGGGCATCGCCGATCACAAT
>probe:Drosophila_2:1629120_at:168:409; Interrogation_Position=662; Antisense; GACGCGCCCACGTTAAACAGGTATA
>probe:Drosophila_2:1629120_at:380:669; Interrogation_Position=700; Antisense; TACGAACGCTGGCAAGAGCCGGCAC
>probe:Drosophila_2:1629120_at:705:413; Interrogation_Position=715; Antisense; GAGCCGGCACTTGAATTAGAAATGT

Paste this into a BLAST search page for me
GCTCTCGTTGAGCAGCAGTACTCCATTTCCCGCAGCGATCTCAACTATATTCAACTATATTCAGGCGGCGACACAGGCGACACATCCGAAGAATCTACAGATGACAGCGGACCAAGCAGTGCGCCGCCCGCAAGCAGTACACTTGGTTCAGTTCAAGCAGTACCGGTCCGCGTATGATTCGATTTCATTGCCAGCAGCAGGCCGCTAACAGCAGCTACTACAAGTAAGGGAGCGATACGCCGCATAGCCATACAATGGGCATCGCCGATCACAATGACGCGCCCACGTTAAACAGGTATATACGAACGCTGGCAAGAGCCGGCACGAGCCGGCACTTGAATTAGAAATGT

Full Affymetrix probeset data:

Annotations for 1629120_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720