FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629121_at:

>probe:Drosophila_2:1629121_at:402:587; Interrogation_Position=1019; Antisense; TGGAGGAGGCTTTTGTTGTCTGTCA
>probe:Drosophila_2:1629121_at:244:467; Interrogation_Position=1033; Antisense; GTTGTCTGTCAATCGTACTCTACTA
>probe:Drosophila_2:1629121_at:522:617; Interrogation_Position=1095; Antisense; TCATTTTACTTTGTGCCTTTATTGC
>probe:Drosophila_2:1629121_at:458:711; Interrogation_Position=1187; Antisense; TTCACATTTATTTTGGCTACGAGAT
>probe:Drosophila_2:1629121_at:545:43; Interrogation_Position=1268; Antisense; ATCCCTTTTTCATTGGGTTCTATAG
>probe:Drosophila_2:1629121_at:175:361; Interrogation_Position=1332; Antisense; GAATATTTAGTTGCGGTTCTGCGAT
>probe:Drosophila_2:1629121_at:357:723; Interrogation_Position=1342; Antisense; TTGCGGTTCTGCGATACGTTCATTA
>probe:Drosophila_2:1629121_at:706:317; Interrogation_Position=773; Antisense; GCCGGCTTGGCGACAGACTATTTTA
>probe:Drosophila_2:1629121_at:303:375; Interrogation_Position=824; Antisense; GAAGATCTTTGAGGCTCTTTCGACA
>probe:Drosophila_2:1629121_at:236:637; Interrogation_Position=843; Antisense; TCGACAAGCGAGTAGTGTTCACACT
>probe:Drosophila_2:1629121_at:559:39; Interrogation_Position=893; Antisense; ATCGAATTCCGAAACACAGTATTGT
>probe:Drosophila_2:1629121_at:85:595; Interrogation_Position=915; Antisense; TGTGGATTTGTGTATCACTCAAGAA
>probe:Drosophila_2:1629121_at:437:509; Interrogation_Position=949; Antisense; GTGCTTTGCGGATTTGAACTCTGAA
>probe:Drosophila_2:1629121_at:429:127; Interrogation_Position=976; Antisense; ACCAGAATCGATTTATACCATACGT

Paste this into a BLAST search page for me
TGGAGGAGGCTTTTGTTGTCTGTCAGTTGTCTGTCAATCGTACTCTACTATCATTTTACTTTGTGCCTTTATTGCTTCACATTTATTTTGGCTACGAGATATCCCTTTTTCATTGGGTTCTATAGGAATATTTAGTTGCGGTTCTGCGATTTGCGGTTCTGCGATACGTTCATTAGCCGGCTTGGCGACAGACTATTTTAGAAGATCTTTGAGGCTCTTTCGACATCGACAAGCGAGTAGTGTTCACACTATCGAATTCCGAAACACAGTATTGTTGTGGATTTGTGTATCACTCAAGAAGTGCTTTGCGGATTTGAACTCTGAAACCAGAATCGATTTATACCATACGT

Full Affymetrix probeset data:

Annotations for 1629121_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720