FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629122_at:

>probe:Drosophila_2:1629122_at:479:577; Interrogation_Position=165; Antisense; GGCCTTTGATTATTTCACAGCGGGT
>probe:Drosophila_2:1629122_at:461:537; Interrogation_Position=187; Antisense; GGTCTGCTGGCATTTATTCCATTGC
>probe:Drosophila_2:1629122_at:250:85; Interrogation_Position=214; Antisense; AGTGAGTTCAAGGTGCTTCTCCTGT
>probe:Drosophila_2:1629122_at:68:95; Interrogation_Position=287; Antisense; AGTTCCTGCGATCCTTTAGCTGTAA
>probe:Drosophila_2:1629122_at:647:331; Interrogation_Position=305; Antisense; GCTGTAACGAATCCTTCGACCAGGT
>probe:Drosophila_2:1629122_at:88:537; Interrogation_Position=327; Antisense; GGTCCTGGGACGTATCACCTTGGAA
>probe:Drosophila_2:1629122_at:64:185; Interrogation_Position=371; Antisense; AACAAGTTTGCTCCGTTCTTAGCCA
>probe:Drosophila_2:1629122_at:505:441; Interrogation_Position=399; Antisense; GATGGTTTTGGCAGATCGCTATCTC
>probe:Drosophila_2:1629122_at:213:163; Interrogation_Position=452; Antisense; AAATAACGCCCAGCATCGAGGATCT
>probe:Drosophila_2:1629122_at:315:41; Interrogation_Position=473; Antisense; ATCTGGTCAACGATGCCATAGCCAA
>probe:Drosophila_2:1629122_at:608:39; Interrogation_Position=587; Antisense; ATCTGCTGCACGGATCCGAATCTGA
>probe:Drosophila_2:1629122_at:662:657; Interrogation_Position=624; Antisense; TAAGGAGCCTATTTCCAAGCCCAAG
>probe:Drosophila_2:1629122_at:676:75; Interrogation_Position=647; Antisense; AGGAGAGACCAATACCGCCGCCGAA
>probe:Drosophila_2:1629122_at:674:233; Interrogation_Position=675; Antisense; AATGCGTCAGCCATCATCAAGCAAC

Paste this into a BLAST search page for me
GGCCTTTGATTATTTCACAGCGGGTGGTCTGCTGGCATTTATTCCATTGCAGTGAGTTCAAGGTGCTTCTCCTGTAGTTCCTGCGATCCTTTAGCTGTAAGCTGTAACGAATCCTTCGACCAGGTGGTCCTGGGACGTATCACCTTGGAAAACAAGTTTGCTCCGTTCTTAGCCAGATGGTTTTGGCAGATCGCTATCTCAAATAACGCCCAGCATCGAGGATCTATCTGGTCAACGATGCCATAGCCAAATCTGCTGCACGGATCCGAATCTGATAAGGAGCCTATTTCCAAGCCCAAGAGGAGAGACCAATACCGCCGCCGAAAATGCGTCAGCCATCATCAAGCAAC

Full Affymetrix probeset data:

Annotations for 1629122_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720