FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629123_at:

>probe:Drosophila_2:1629123_at:677:457; Interrogation_Position=3045; Antisense; GATTTTTTGTAAGACAGGCGGCCCA
>probe:Drosophila_2:1629123_at:608:71; Interrogation_Position=3060; Antisense; AGGCGGCCCAAGGAGTTCACAACTA
>probe:Drosophila_2:1629123_at:685:191; Interrogation_Position=3080; Antisense; AACTACTTCCATTGTATCCTTGAAC
>probe:Drosophila_2:1629123_at:511:603; Interrogation_Position=3120; Antisense; TGTTGTACATTGAGTGCCCATCCAC
>probe:Drosophila_2:1629123_at:612:625; Interrogation_Position=3134; Antisense; TGCCCATCCACAAGCTACATGTAAT
>probe:Drosophila_2:1629123_at:533:121; Interrogation_Position=3168; Antisense; AGCGTAGACCTAAGACCGATGATAT
>probe:Drosophila_2:1629123_at:38:455; Interrogation_Position=3212; Antisense; GATACATTTACCAGCGCAGAATCGT
>probe:Drosophila_2:1629123_at:718:33; Interrogation_Position=3255; Antisense; ATCACTGTCCGTATGGTTAGTCTAG
>probe:Drosophila_2:1629123_at:574:643; Interrogation_Position=3275; Antisense; TCTAGTTTAGTTCCTTTGTTTCAAT
>probe:Drosophila_2:1629123_at:17:479; Interrogation_Position=3292; Antisense; GTTTCAATCTATGTACCTACAGCCA
>probe:Drosophila_2:1629123_at:296:43; Interrogation_Position=3325; Antisense; ATCGTCTCCGATTCACCTATATTAT
>probe:Drosophila_2:1629123_at:70:169; Interrogation_Position=3365; Antisense; AAATGTTGTACCTAGCAGGTGCGTA
>probe:Drosophila_2:1629123_at:36:685; Interrogation_Position=3449; Antisense; TATCGCGACACATTGAACCAGCTTC
>probe:Drosophila_2:1629123_at:339:307; Interrogation_Position=3484; Antisense; GCCCACCCGGAATTTGAGTTCTTTG

Paste this into a BLAST search page for me
GATTTTTTGTAAGACAGGCGGCCCAAGGCGGCCCAAGGAGTTCACAACTAAACTACTTCCATTGTATCCTTGAACTGTTGTACATTGAGTGCCCATCCACTGCCCATCCACAAGCTACATGTAATAGCGTAGACCTAAGACCGATGATATGATACATTTACCAGCGCAGAATCGTATCACTGTCCGTATGGTTAGTCTAGTCTAGTTTAGTTCCTTTGTTTCAATGTTTCAATCTATGTACCTACAGCCAATCGTCTCCGATTCACCTATATTATAAATGTTGTACCTAGCAGGTGCGTATATCGCGACACATTGAACCAGCTTCGCCCACCCGGAATTTGAGTTCTTTG

Full Affymetrix probeset data:

Annotations for 1629123_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720