FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629124_at:

>probe:Drosophila_2:1629124_at:570:339; Interrogation_Position=1027; Antisense; GCTAAGCGTCAAAGAGCTGCCAGAA
>probe:Drosophila_2:1629124_at:620:697; Interrogation_Position=1111; Antisense; TTTTTCGTGCGAGAGATGTCGTCGT
>probe:Drosophila_2:1629124_at:43:443; Interrogation_Position=1125; Antisense; GATGTCGTCGTTTCATAAGGACTTC
>probe:Drosophila_2:1629124_at:342:225; Interrogation_Position=1141; Antisense; AAGGACTTCATGGATCTTCTATCTA
>probe:Drosophila_2:1629124_at:31:271; Interrogation_Position=1156; Antisense; CTTCTATCTAATCCCAAAGGCGGCG
>probe:Drosophila_2:1629124_at:364:257; Interrogation_Position=1170; Antisense; CAAAGGCGGCGCACATGCATAAATA
>probe:Drosophila_2:1629124_at:107:345; Interrogation_Position=1186; Antisense; GCATAAATACCTGTTCGCGATTTGA
>probe:Drosophila_2:1629124_at:418:163; Interrogation_Position=1309; Antisense; AAATATCTCATTTCGGCAGTCACTC
>probe:Drosophila_2:1629124_at:285:289; Interrogation_Position=1322; Antisense; CGGCAGTCACTCAATTTTTTATTTC
>probe:Drosophila_2:1629124_at:293:545; Interrogation_Position=900; Antisense; GGATGAACTGCGTATTCTGAAGGAT
>probe:Drosophila_2:1629124_at:712:393; Interrogation_Position=937; Antisense; GAAATCGAAGAGTCGTCCACAGTTC
>probe:Drosophila_2:1629124_at:320:291; Interrogation_Position=950; Antisense; CGTCCACAGTTCATTCCCAGGAAAA
>probe:Drosophila_2:1629124_at:707:387; Interrogation_Position=970; Antisense; GAAAACTATGAAGACGAGCTCGATC
>probe:Drosophila_2:1629124_at:422:419; Interrogation_Position=985; Antisense; GAGCTCGATCAACAGAATTCCAAGA

Paste this into a BLAST search page for me
GCTAAGCGTCAAAGAGCTGCCAGAATTTTTCGTGCGAGAGATGTCGTCGTGATGTCGTCGTTTCATAAGGACTTCAAGGACTTCATGGATCTTCTATCTACTTCTATCTAATCCCAAAGGCGGCGCAAAGGCGGCGCACATGCATAAATAGCATAAATACCTGTTCGCGATTTGAAAATATCTCATTTCGGCAGTCACTCCGGCAGTCACTCAATTTTTTATTTCGGATGAACTGCGTATTCTGAAGGATGAAATCGAAGAGTCGTCCACAGTTCCGTCCACAGTTCATTCCCAGGAAAAGAAAACTATGAAGACGAGCTCGATCGAGCTCGATCAACAGAATTCCAAGA

Full Affymetrix probeset data:

Annotations for 1629124_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720