FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629127_at:

>probe:Drosophila_2:1629127_at:200:605; Interrogation_Position=491; Antisense; TGATCAATGGAACCTGTCCGGGCAC
>probe:Drosophila_2:1629127_at:44:369; Interrogation_Position=558; Antisense; GAATGTGGAGTGTGACTTCGTCCCA
>probe:Drosophila_2:1629127_at:369:149; Interrogation_Position=572; Antisense; ACTTCGTCCCAGTGCCAGATATTAG
>probe:Drosophila_2:1629127_at:543:249; Interrogation_Position=651; Antisense; CAATGGCTACTACTACTGCAAGGAT
>probe:Drosophila_2:1629127_at:532:101; Interrogation_Position=687; Antisense; AGAGTTCTCGCTGGAGCATGGCGTC
>probe:Drosophila_2:1629127_at:412:65; Interrogation_Position=719; Antisense; ATGGAAGATTTTTCCTGGCCACCGA
>probe:Drosophila_2:1629127_at:191:597; Interrogation_Position=754; Antisense; TGTGTCCCGCGATCCAAGGTGAAAT
>probe:Drosophila_2:1629127_at:214:167; Interrogation_Position=775; Antisense; AAATGCGGCTACGATCGATGCGTGG
>probe:Drosophila_2:1629127_at:579:729; Interrogation_Position=802; Antisense; TTGGGCAATTCCACCATTCAGCTGG
>probe:Drosophila_2:1629127_at:435:11; Interrogation_Position=817; Antisense; ATTCAGCTGGCCAACGAGTCGGATG
>probe:Drosophila_2:1629127_at:357:571; Interrogation_Position=853; Antisense; GGCTACTCGATCTGCCAGGATGGCA
>probe:Drosophila_2:1629127_at:689:309; Interrogation_Position=887; Antisense; GCCAAGGAACTTGTCCGCAGGACGA
>probe:Drosophila_2:1629127_at:439:497; Interrogation_Position=949; Antisense; GTCATATCATATACCGCCTGTCAGA
>probe:Drosophila_2:1629127_at:293:531; Interrogation_Position=991; Antisense; GGGTCCCAAGTTCCAAGTGGCACCA

Paste this into a BLAST search page for me
TGATCAATGGAACCTGTCCGGGCACGAATGTGGAGTGTGACTTCGTCCCAACTTCGTCCCAGTGCCAGATATTAGCAATGGCTACTACTACTGCAAGGATAGAGTTCTCGCTGGAGCATGGCGTCATGGAAGATTTTTCCTGGCCACCGATGTGTCCCGCGATCCAAGGTGAAATAAATGCGGCTACGATCGATGCGTGGTTGGGCAATTCCACCATTCAGCTGGATTCAGCTGGCCAACGAGTCGGATGGGCTACTCGATCTGCCAGGATGGCAGCCAAGGAACTTGTCCGCAGGACGAGTCATATCATATACCGCCTGTCAGAGGGTCCCAAGTTCCAAGTGGCACCA

Full Affymetrix probeset data:

Annotations for 1629127_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720