FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629128_at:

>probe:Drosophila_2:1629128_at:19:229; Interrogation_Position=498; Antisense; AAGGCCACGCGCAAGTACCAGGTCA
>probe:Drosophila_2:1629128_at:522:549; Interrogation_Position=530; Antisense; GGAGTGTCCGCCCATAAAGATAAAG
>probe:Drosophila_2:1629128_at:111:215; Interrogation_Position=561; Antisense; AAGATCTGCTGCTACGAGGCGGGAA
>probe:Drosophila_2:1629128_at:184:211; Interrogation_Position=615; Antisense; AAGAAGTTCGTGACATCCGCCGAGT
>probe:Drosophila_2:1629128_at:689:135; Interrogation_Position=645; Antisense; ACGAATGTCGAATGCCCCACGGAGG
>probe:Drosophila_2:1629128_at:665:437; Interrogation_Position=670; Antisense; GAGGACCCTGCCCTAGAATCAAGAT
>probe:Drosophila_2:1629128_at:175:599; Interrogation_Position=702; Antisense; TGTAAGGCCGTAGACAGCGTCTCTT
>probe:Drosophila_2:1629128_at:348:315; Interrogation_Position=838; Antisense; GCCTAGATGTTCCAAGCTCCTGTGA
>probe:Drosophila_2:1629128_at:639:629; Interrogation_Position=855; Antisense; TCCTGTGACCTGATTCGTGAGCTGA
>probe:Drosophila_2:1629128_at:73:395; Interrogation_Position=892; Antisense; GAAATCCACGGAAGCCAAACTGCGG
>probe:Drosophila_2:1629128_at:444:485; Interrogation_Position=922; Antisense; GTAGGGCTTAATTCCATAGTGCTGT
>probe:Drosophila_2:1629128_at:691:85; Interrogation_Position=939; Antisense; AGTGCTGTTTGAATCCTAATCCCAG
>probe:Drosophila_2:1629128_at:586:655; Interrogation_Position=955; Antisense; TAATCCCAGCGCTCAGTATCTTGTT
>probe:Drosophila_2:1629128_at:495:265; Interrogation_Position=968; Antisense; CAGTATCTTGTTCCGTTGACCTAAA

Paste this into a BLAST search page for me
AAGGCCACGCGCAAGTACCAGGTCAGGAGTGTCCGCCCATAAAGATAAAGAAGATCTGCTGCTACGAGGCGGGAAAAGAAGTTCGTGACATCCGCCGAGTACGAATGTCGAATGCCCCACGGAGGGAGGACCCTGCCCTAGAATCAAGATTGTAAGGCCGTAGACAGCGTCTCTTGCCTAGATGTTCCAAGCTCCTGTGATCCTGTGACCTGATTCGTGAGCTGAGAAATCCACGGAAGCCAAACTGCGGGTAGGGCTTAATTCCATAGTGCTGTAGTGCTGTTTGAATCCTAATCCCAGTAATCCCAGCGCTCAGTATCTTGTTCAGTATCTTGTTCCGTTGACCTAAA

Full Affymetrix probeset data:

Annotations for 1629128_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720