Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629129_at:

>probe:Drosophila_2:1629129_at:13:601; Interrogation_Position=3680; Antisense; TGTACTTCAATCACCGGATCTCGGA
>probe:Drosophila_2:1629129_at:675:239; Interrogation_Position=3717; Antisense; AATATGACGCTGACTGAGCCAACCC
>probe:Drosophila_2:1629129_at:565:437; Interrogation_Position=3752; Antisense; GAGGAGCCACCAACTAACTGTGCAT
>probe:Drosophila_2:1629129_at:630:659; Interrogation_Position=3766; Antisense; TAACTGTGCATCTCAACCAATCCAT
>probe:Drosophila_2:1629129_at:380:17; Interrogation_Position=3821; Antisense; ATTTGCCCACTTGTAGATCTTTCGA
>probe:Drosophila_2:1629129_at:105:409; Interrogation_Position=3862; Antisense; GACGTCCTTGTCGAGCAGTATTATT
>probe:Drosophila_2:1629129_at:664:653; Interrogation_Position=3900; Antisense; TAATTTTCCATTTCGAATGCCCCGG
>probe:Drosophila_2:1629129_at:307:623; Interrogation_Position=3917; Antisense; TGCCCCGGAAGTTTCTTTCATTGTA
>probe:Drosophila_2:1629129_at:509:615; Interrogation_Position=3991; Antisense; TGAATGGCGCTACCTATGCTTAGTT
>probe:Drosophila_2:1629129_at:397:93; Interrogation_Position=4019; Antisense; AGTTCGTCACTTAGTTCTTCTAGTC
>probe:Drosophila_2:1629129_at:513:183; Interrogation_Position=4051; Antisense; AAAATCCCATCTTCGAGTTGAGCTA
>probe:Drosophila_2:1629129_at:580:93; Interrogation_Position=4066; Antisense; AGTTGAGCTATTTCCCCTGGATGTA
>probe:Drosophila_2:1629129_at:137:723; Interrogation_Position=4120; Antisense; TTGAAACCCCGTCGTCAGTAATAAG
>probe:Drosophila_2:1629129_at:447:237; Interrogation_Position=4151; Antisense; AATCGTTGATTTAGGCGTGCAGCGC

Paste this into a BLAST search page for me
TGTACTTCAATCACCGGATCTCGGAAATATGACGCTGACTGAGCCAACCCGAGGAGCCACCAACTAACTGTGCATTAACTGTGCATCTCAACCAATCCATATTTGCCCACTTGTAGATCTTTCGAGACGTCCTTGTCGAGCAGTATTATTTAATTTTCCATTTCGAATGCCCCGGTGCCCCGGAAGTTTCTTTCATTGTATGAATGGCGCTACCTATGCTTAGTTAGTTCGTCACTTAGTTCTTCTAGTCAAAATCCCATCTTCGAGTTGAGCTAAGTTGAGCTATTTCCCCTGGATGTATTGAAACCCCGTCGTCAGTAATAAGAATCGTTGATTTAGGCGTGCAGCGC

Full Affymetrix probeset data:

Annotations for 1629129_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime