FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629130_at:

>probe:Drosophila_2:1629130_at:1:289; Interrogation_Position=3388; Antisense; CTGGCCAGCGTGTCATTTGTACAAA
>probe:Drosophila_2:1629130_at:256:541; Interrogation_Position=3441; Antisense; GGTTCAGGTCACGACACAGTGCAAT
>probe:Drosophila_2:1629130_at:686:605; Interrogation_Position=3545; Antisense; TGATGCCTCTGAGAACCAGGTGCTT
>probe:Drosophila_2:1629130_at:497:639; Interrogation_Position=3569; Antisense; TCGTGGATTTGATTCAGGGCGCCGT
>probe:Drosophila_2:1629130_at:626:407; Interrogation_Position=3595; Antisense; GACGGATACCTCGATGTTGCCGCAT
>probe:Drosophila_2:1629130_at:572:299; Interrogation_Position=3627; Antisense; CCGTCTTCTTCACTTATGGGAGGGC
>probe:Drosophila_2:1629130_at:6:437; Interrogation_Position=3655; Antisense; GAGGATTTCCGTGAGCATCTTGAAT
>probe:Drosophila_2:1629130_at:228:615; Interrogation_Position=3732; Antisense; TGAAGGATTTGTGGCTGCTCTGGAC
>probe:Drosophila_2:1629130_at:379:661; Interrogation_Position=3770; Antisense; TAAAGTTGGCCCTTAAGCCTGCATC
>probe:Drosophila_2:1629130_at:596:35; Interrogation_Position=3792; Antisense; ATCTTCGGCGCTTTTGCAACAAATC
>probe:Drosophila_2:1629130_at:254:123; Interrogation_Position=3821; Antisense; AGCGAATCCACACAAGACTTCTGCT
>probe:Drosophila_2:1629130_at:466:619; Interrogation_Position=3842; Antisense; TGCTCTTCCATAACCACAAGGCGGA
>probe:Drosophila_2:1629130_at:726:563; Interrogation_Position=3864; Antisense; GGAATCGGAGTTCTGCTGCACTGTC
>probe:Drosophila_2:1629130_at:124:363; Interrogation_Position=3908; Antisense; GCAATTCCACCTTGTTCAGAGCTAA

Paste this into a BLAST search page for me
CTGGCCAGCGTGTCATTTGTACAAAGGTTCAGGTCACGACACAGTGCAATTGATGCCTCTGAGAACCAGGTGCTTTCGTGGATTTGATTCAGGGCGCCGTGACGGATACCTCGATGTTGCCGCATCCGTCTTCTTCACTTATGGGAGGGCGAGGATTTCCGTGAGCATCTTGAATTGAAGGATTTGTGGCTGCTCTGGACTAAAGTTGGCCCTTAAGCCTGCATCATCTTCGGCGCTTTTGCAACAAATCAGCGAATCCACACAAGACTTCTGCTTGCTCTTCCATAACCACAAGGCGGAGGAATCGGAGTTCTGCTGCACTGTCGCAATTCCACCTTGTTCAGAGCTAA

Full Affymetrix probeset data:

Annotations for 1629130_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720