Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629132_at:

>probe:Drosophila_2:1629132_at:278:717; Interrogation_Position=1002; Antisense; TTCGTATGTATGTTTGCGCTGTGTA
>probe:Drosophila_2:1629132_at:86:427; Interrogation_Position=1036; Antisense; GAGAGACTTGCATACATACTGCTAT
>probe:Drosophila_2:1629132_at:516:23; Interrogation_Position=1097; Antisense; ATATCTATGTGCTATCTGTATCTAC
>probe:Drosophila_2:1629132_at:407:61; Interrogation_Position=1160; Antisense; ATGTACACATTACGCATCCCAACTA
>probe:Drosophila_2:1629132_at:657:121; Interrogation_Position=653; Antisense; AGCGGGATCTCCACGAACGCGAGGT
>probe:Drosophila_2:1629132_at:657:403; Interrogation_Position=682; Antisense; GACTACAAGATCAAGCTGCGGGCCG
>probe:Drosophila_2:1629132_at:116:195; Interrogation_Position=800; Antisense; AACTGGGCAAGTCGAAGGCCGAACT
>probe:Drosophila_2:1629132_at:165:407; Interrogation_Position=862; Antisense; GACTGGGAGTCCACCAAGCAGAGGA
>probe:Drosophila_2:1629132_at:177:451; Interrogation_Position=885; Antisense; GATCGCCCGACTGGAGCTGGAGAAC
>probe:Drosophila_2:1629132_at:651:295; Interrogation_Position=909; Antisense; CGAGCGGCTGAAACACGATCTGGAG
>probe:Drosophila_2:1629132_at:25:453; Interrogation_Position=925; Antisense; GATCTGGAGCGTTCGCAGGTACTCG
>probe:Drosophila_2:1629132_at:318:265; Interrogation_Position=940; Antisense; CAGGTACTCGTGCATTATGACCAGT
>probe:Drosophila_2:1629132_at:206:15; Interrogation_Position=953; Antisense; ATTATGACCAGTTTCCCCGACATTA
>probe:Drosophila_2:1629132_at:498:191; Interrogation_Position=985; Antisense; AACTTATCATCAGTCTATTCGTATG

Paste this into a BLAST search page for me
TTCGTATGTATGTTTGCGCTGTGTAGAGAGACTTGCATACATACTGCTATATATCTATGTGCTATCTGTATCTACATGTACACATTACGCATCCCAACTAAGCGGGATCTCCACGAACGCGAGGTGACTACAAGATCAAGCTGCGGGCCGAACTGGGCAAGTCGAAGGCCGAACTGACTGGGAGTCCACCAAGCAGAGGAGATCGCCCGACTGGAGCTGGAGAACCGAGCGGCTGAAACACGATCTGGAGGATCTGGAGCGTTCGCAGGTACTCGCAGGTACTCGTGCATTATGACCAGTATTATGACCAGTTTCCCCGACATTAAACTTATCATCAGTCTATTCGTATG

Full Affymetrix probeset data:

Annotations for 1629132_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime