FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629133_at:

>probe:Drosophila_2:1629133_at:177:71; Interrogation_Position=2677; Antisense; AGGCGCGCAGCAAGCGTTCGTAGAA
>probe:Drosophila_2:1629133_at:359:467; Interrogation_Position=2692; Antisense; GTTCGTAGAACCAGTACCCAGACTC
>probe:Drosophila_2:1629133_at:209:377; Interrogation_Position=2725; Antisense; GAAGCAGCAGCCTTTAGTTTAAGCA
>probe:Drosophila_2:1629133_at:34:85; Interrogation_Position=2793; Antisense; AGTGGAGCAGCACCAATCTCAGTGG
>probe:Drosophila_2:1629133_at:43:93; Interrogation_Position=2860; Antisense; AGTTCAACTTCATCGCATCAATCAT
>probe:Drosophila_2:1629133_at:225:37; Interrogation_Position=2880; Antisense; ATCATCGCAATGCAAAGCCTCGGCA
>probe:Drosophila_2:1629133_at:692:123; Interrogation_Position=2895; Antisense; AGCCTCGGCAGTACTTTTAAATCAC
>probe:Drosophila_2:1629133_at:226:699; Interrogation_Position=2910; Antisense; TTTAAATCACACAATCCTCCAATCC
>probe:Drosophila_2:1629133_at:572:687; Interrogation_Position=2951; Antisense; TATATATTTGCCTTATGACCAGTGC
>probe:Drosophila_2:1629133_at:508:175; Interrogation_Position=2992; Antisense; AAACCACGGATGTGCACGGCTGCAG
>probe:Drosophila_2:1629133_at:362:349; Interrogation_Position=3013; Antisense; GCAGGCTGATCCATGCCAGTGGGCA
>probe:Drosophila_2:1629133_at:68:545; Interrogation_Position=3040; Antisense; GGATCTCTGGTATCAAACGCCGTAT
>probe:Drosophila_2:1629133_at:205:31; Interrogation_Position=3088; Antisense; ATAAATCGCATAAACCCGCATCGCA
>probe:Drosophila_2:1629133_at:323:301; Interrogation_Position=3102; Antisense; CCCGCATCGCATACTTTACTTTTAT

Paste this into a BLAST search page for me
AGGCGCGCAGCAAGCGTTCGTAGAAGTTCGTAGAACCAGTACCCAGACTCGAAGCAGCAGCCTTTAGTTTAAGCAAGTGGAGCAGCACCAATCTCAGTGGAGTTCAACTTCATCGCATCAATCATATCATCGCAATGCAAAGCCTCGGCAAGCCTCGGCAGTACTTTTAAATCACTTTAAATCACACAATCCTCCAATCCTATATATTTGCCTTATGACCAGTGCAAACCACGGATGTGCACGGCTGCAGGCAGGCTGATCCATGCCAGTGGGCAGGATCTCTGGTATCAAACGCCGTATATAAATCGCATAAACCCGCATCGCACCCGCATCGCATACTTTACTTTTAT

Full Affymetrix probeset data:

Annotations for 1629133_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720