FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629134_at:

>probe:Drosophila_2:1629134_at:418:91; Interrogation_Position=2812; Antisense; AGTTTTACTGCCTCTCTCATAAGTC
>probe:Drosophila_2:1629134_at:92:91; Interrogation_Position=2890; Antisense; AGTACGCAGGGCATCACCGATATGA
>probe:Drosophila_2:1629134_at:348:615; Interrogation_Position=2942; Antisense; TGAAGGCCACGCTGATTTTGTCCGC
>probe:Drosophila_2:1629134_at:726:19; Interrogation_Position=2972; Antisense; ATATTTTCCCGGACGAGGATGCCTT
>probe:Drosophila_2:1629134_at:479:447; Interrogation_Position=2989; Antisense; GATGCCTTCTGCTACACGGAGGGAT
>probe:Drosophila_2:1629134_at:659:65; Interrogation_Position=3034; Antisense; ATGGAGATGCACTGCTATGCCTGTC
>probe:Drosophila_2:1629134_at:321:581; Interrogation_Position=3068; Antisense; TGGCCCAGTCGCACAACTTTAGTTG
>probe:Drosophila_2:1629134_at:664:93; Interrogation_Position=3088; Antisense; AGTTGGTCACGTTGGAACCTTCTGG
>probe:Drosophila_2:1629134_at:353:27; Interrogation_Position=3171; Antisense; ATACTACTCCACTCTATTGGTTACC
>probe:Drosophila_2:1629134_at:607:587; Interrogation_Position=3188; Antisense; TGGTTACCCCACTAAAGACTTCGAT
>probe:Drosophila_2:1629134_at:316:355; Interrogation_Position=3221; Antisense; GCACGGAAGTATCGGCCAGTTTCAA
>probe:Drosophila_2:1629134_at:644:277; Interrogation_Position=3283; Antisense; CTATATCAACTATCGCAGGCTCATG
>probe:Drosophila_2:1629134_at:202:101; Interrogation_Position=3332; Antisense; AGAGGACCATGAATCCCGTGCTCAG
>probe:Drosophila_2:1629134_at:128:703; Interrogation_Position=3374; Antisense; TTTTGATGGCCATTCGACCGCTGAG

Paste this into a BLAST search page for me
AGTTTTACTGCCTCTCTCATAAGTCAGTACGCAGGGCATCACCGATATGATGAAGGCCACGCTGATTTTGTCCGCATATTTTCCCGGACGAGGATGCCTTGATGCCTTCTGCTACACGGAGGGATATGGAGATGCACTGCTATGCCTGTCTGGCCCAGTCGCACAACTTTAGTTGAGTTGGTCACGTTGGAACCTTCTGGATACTACTCCACTCTATTGGTTACCTGGTTACCCCACTAAAGACTTCGATGCACGGAAGTATCGGCCAGTTTCAACTATATCAACTATCGCAGGCTCATGAGAGGACCATGAATCCCGTGCTCAGTTTTGATGGCCATTCGACCGCTGAG

Full Affymetrix probeset data:

Annotations for 1629134_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720