FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629136_at:

>probe:Drosophila_2:1629136_at:670:31; Interrogation_Position=123; Antisense; ATAATCGCCGAATTCAGTACAGCTG
>probe:Drosophila_2:1629136_at:333:491; Interrogation_Position=139; Antisense; GTACAGCTGAGACGGACCACGACAA
>probe:Drosophila_2:1629136_at:86:161; Interrogation_Position=160; Antisense; ACAAGAACCGACGAGGTGCCAACAT
>probe:Drosophila_2:1629136_at:223:467; Interrogation_Position=207; Antisense; GTTGGTCGCAGCGATCCCAGTCTGG
>probe:Drosophila_2:1629136_at:728:579; Interrogation_Position=230; Antisense; GGCCAACAGTCTGCGCGACGGATTA
>probe:Drosophila_2:1629136_at:161:83; Interrogation_Position=263; Antisense; AGTCCTCGACGGCATTTACGGAGAT
>probe:Drosophila_2:1629136_at:27:709; Interrogation_Position=278; Antisense; TTACGGAGATGCCTCCCAGGAGGAT
>probe:Drosophila_2:1629136_at:424:175; Interrogation_Position=327; Antisense; AAAGCCAGTGGTCTGGTGGCCTTCC
>probe:Drosophila_2:1629136_at:541:295; Interrogation_Position=374; Antisense; CGAGCTGAGGAAGTGGGCCCACCTT
>probe:Drosophila_2:1629136_at:198:717; Interrogation_Position=397; Antisense; TTCTGGCTCTGCAACAGGTGCTGGA
>probe:Drosophila_2:1629136_at:624:315; Interrogation_Position=441; Antisense; GCCTCCTCGGGATTGTGGTTCGGTC
>probe:Drosophila_2:1629136_at:85:521; Interrogation_Position=486; Antisense; GTGGACGCCAAGTCGTTTGCGGACA
>probe:Drosophila_2:1629136_at:59:695; Interrogation_Position=501; Antisense; TTTGCGGACATCTCCAAGGGACAGA
>probe:Drosophila_2:1629136_at:561:383; Interrogation_Position=528; Antisense; GAACTCAACTAGACACACTGACTCC

Paste this into a BLAST search page for me
ATAATCGCCGAATTCAGTACAGCTGGTACAGCTGAGACGGACCACGACAAACAAGAACCGACGAGGTGCCAACATGTTGGTCGCAGCGATCCCAGTCTGGGGCCAACAGTCTGCGCGACGGATTAAGTCCTCGACGGCATTTACGGAGATTTACGGAGATGCCTCCCAGGAGGATAAAGCCAGTGGTCTGGTGGCCTTCCCGAGCTGAGGAAGTGGGCCCACCTTTTCTGGCTCTGCAACAGGTGCTGGAGCCTCCTCGGGATTGTGGTTCGGTCGTGGACGCCAAGTCGTTTGCGGACATTTGCGGACATCTCCAAGGGACAGAGAACTCAACTAGACACACTGACTCC

Full Affymetrix probeset data:

Annotations for 1629136_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720