Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629140_at:

>probe:Drosophila_2:1629140_at:491:419; Interrogation_Position=123; Antisense; GAGCTTCAGCAGATTATCCTCAGCA
>probe:Drosophila_2:1629140_at:482:659; Interrogation_Position=155; Antisense; TAACCCTGCAGTCCCGAAAGCAAAC
>probe:Drosophila_2:1629140_at:35:211; Interrogation_Position=172; Antisense; AAGCAAACACATCAGCTGCTCGTTC
>probe:Drosophila_2:1629140_at:276:33; Interrogation_Position=19; Antisense; ATCACGGTTGTTTGCCTCGTATTCA
>probe:Drosophila_2:1629140_at:56:471; Interrogation_Position=193; Antisense; GTTCCCTCTGCCAGGATTGTTAATC
>probe:Drosophila_2:1629140_at:614:5; Interrogation_Position=208; Antisense; ATTGTTAATCATCACCAGGCGGCAG
>probe:Drosophila_2:1629140_at:714:95; Interrogation_Position=251; Antisense; AGAGGTTCTTTCAGGCGGCAACGGC
>probe:Drosophila_2:1629140_at:279:77; Interrogation_Position=284; Antisense; AGGAGGTGCCTGTCATCTCTGGACA
>probe:Drosophila_2:1629140_at:14:49; Interrogation_Position=338; Antisense; ATCCAGTGGTGCACCAGATGCTGCC
>probe:Drosophila_2:1629140_at:246:389; Interrogation_Position=380; Antisense; GAAACATTAGCTACGCCTCCCTGAT
>probe:Drosophila_2:1629140_at:73:353; Interrogation_Position=416; Antisense; GCAGCCTGAACACTCATACGAATCG
>probe:Drosophila_2:1629140_at:138:235; Interrogation_Position=435; Antisense; GAATCGGAATTTGTCACCCGTTTGA
>probe:Drosophila_2:1629140_at:181:397; Interrogation_Position=75; Antisense; GACAATCCTGCATGGCAACGGACAG
>probe:Drosophila_2:1629140_at:567:357; Interrogation_Position=89; Antisense; GCAACGGACAGGTGGCCAGTGCCAT

Paste this into a BLAST search page for me
GAGCTTCAGCAGATTATCCTCAGCATAACCCTGCAGTCCCGAAAGCAAACAAGCAAACACATCAGCTGCTCGTTCATCACGGTTGTTTGCCTCGTATTCAGTTCCCTCTGCCAGGATTGTTAATCATTGTTAATCATCACCAGGCGGCAGAGAGGTTCTTTCAGGCGGCAACGGCAGGAGGTGCCTGTCATCTCTGGACAATCCAGTGGTGCACCAGATGCTGCCGAAACATTAGCTACGCCTCCCTGATGCAGCCTGAACACTCATACGAATCGGAATCGGAATTTGTCACCCGTTTGAGACAATCCTGCATGGCAACGGACAGGCAACGGACAGGTGGCCAGTGCCAT

Full Affymetrix probeset data:

Annotations for 1629140_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime