Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629142_at:

>probe:Drosophila_2:1629142_at:1:139; Interrogation_Position=1990; Antisense; ACGATGACGATGGAGCGCTGACCAC
>probe:Drosophila_2:1629142_at:330:285; Interrogation_Position=2007; Antisense; CTGACCACGCGATATGTTCCATGAG
>probe:Drosophila_2:1629142_at:715:467; Interrogation_Position=2022; Antisense; GTTCCATGAGATTCGGTCACGGCGG
>probe:Drosophila_2:1629142_at:497:141; Interrogation_Position=2091; Antisense; ACGGAGCTGCTGTAGGCCGGCAAAT
>probe:Drosophila_2:1629142_at:198:539; Interrogation_Position=2117; Antisense; GGTTCCTAAAACCAACTCGATGTCT
>probe:Drosophila_2:1629142_at:309:443; Interrogation_Position=2135; Antisense; GATGTCTCACAGTTTAAACCGTAAG
>probe:Drosophila_2:1629142_at:242:641; Interrogation_Position=2172; Antisense; TCTACCCTACTGATCCAGTGGATAT
>probe:Drosophila_2:1629142_at:598:599; Interrogation_Position=2204; Antisense; TGTAAGTATTATCAGCGCGTCCCCG
>probe:Drosophila_2:1629142_at:445:503; Interrogation_Position=2222; Antisense; GTCCCCGAGACTAAGCAATCAACTA
>probe:Drosophila_2:1629142_at:723:77; Interrogation_Position=2346; Antisense; AGGTCTAAGATCTTCAACCCGGCAC
>probe:Drosophila_2:1629142_at:246:199; Interrogation_Position=2361; Antisense; AACCCGGCACCTAAGAGAGCTTCTA
>probe:Drosophila_2:1629142_at:231:729; Interrogation_Position=2399; Antisense; TTGGATATTCATGGCGGTTTGTCTC
>probe:Drosophila_2:1629142_at:213:539; Interrogation_Position=2414; Antisense; GGTTTGTCTCCATGCAAATGCGATT
>probe:Drosophila_2:1629142_at:680:511; Interrogation_Position=2447; Antisense; GTGACACATGTCACTTGCCACATTT

Paste this into a BLAST search page for me
ACGATGACGATGGAGCGCTGACCACCTGACCACGCGATATGTTCCATGAGGTTCCATGAGATTCGGTCACGGCGGACGGAGCTGCTGTAGGCCGGCAAATGGTTCCTAAAACCAACTCGATGTCTGATGTCTCACAGTTTAAACCGTAAGTCTACCCTACTGATCCAGTGGATATTGTAAGTATTATCAGCGCGTCCCCGGTCCCCGAGACTAAGCAATCAACTAAGGTCTAAGATCTTCAACCCGGCACAACCCGGCACCTAAGAGAGCTTCTATTGGATATTCATGGCGGTTTGTCTCGGTTTGTCTCCATGCAAATGCGATTGTGACACATGTCACTTGCCACATTT

Full Affymetrix probeset data:

Annotations for 1629142_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime