FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629143_at:

>probe:Drosophila_2:1629143_at:414:393; Interrogation_Position=197; Antisense; GAAAGCAGGTCACTTGTATGGCCAA
>probe:Drosophila_2:1629143_at:213:95; Interrogation_Position=253; Antisense; AGTTGGGCAACAGCCACATCGAGAT
>probe:Drosophila_2:1629143_at:391:351; Interrogation_Position=297; Antisense; GCAGATACTGCTGATGCTTCTCGAA
>probe:Drosophila_2:1629143_at:630:93; Interrogation_Position=334; Antisense; AGTTGTGTGTTTTCCGAGCTGAGCA
>probe:Drosophila_2:1629143_at:151:635; Interrogation_Position=397; Antisense; TCGAAAATTCGGTGAGCGCTCTAAT
>probe:Drosophila_2:1629143_at:657:323; Interrogation_Position=412; Antisense; GCGCTCTAATTATGGCTTGCAGCAA
>probe:Drosophila_2:1629143_at:283:149; Interrogation_Position=524; Antisense; ACTTTCGATTTTACTGCTCTGCATA
>probe:Drosophila_2:1629143_at:187:643; Interrogation_Position=541; Antisense; TCTGCATACCGGCTGCATTGTAATT
>probe:Drosophila_2:1629143_at:96:655; Interrogation_Position=561; Antisense; TAATTAGCAGCATCTCACTTTCCTC
>probe:Drosophila_2:1629143_at:228:259; Interrogation_Position=576; Antisense; CACTTTCCTCATTGTGGCATTCAAA
>probe:Drosophila_2:1629143_at:574:625; Interrogation_Position=611; Antisense; TGCCCGAATCATTTGCTCATTTGCA
>probe:Drosophila_2:1629143_at:522:347; Interrogation_Position=633; Antisense; GCATGCGAGCCGCTATAAGGCCATA
>probe:Drosophila_2:1629143_at:476:687; Interrogation_Position=667; Antisense; TATTCAGTTAGCATCCAATCCACCT
>probe:Drosophila_2:1629143_at:328:45; Interrogation_Position=684; Antisense; ATCCACCTAAGTTATGCCGATTCGC

Paste this into a BLAST search page for me
GAAAGCAGGTCACTTGTATGGCCAAAGTTGGGCAACAGCCACATCGAGATGCAGATACTGCTGATGCTTCTCGAAAGTTGTGTGTTTTCCGAGCTGAGCATCGAAAATTCGGTGAGCGCTCTAATGCGCTCTAATTATGGCTTGCAGCAAACTTTCGATTTTACTGCTCTGCATATCTGCATACCGGCTGCATTGTAATTTAATTAGCAGCATCTCACTTTCCTCCACTTTCCTCATTGTGGCATTCAAATGCCCGAATCATTTGCTCATTTGCAGCATGCGAGCCGCTATAAGGCCATATATTCAGTTAGCATCCAATCCACCTATCCACCTAAGTTATGCCGATTCGC

Full Affymetrix probeset data:

Annotations for 1629143_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720