FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629144_at:

>probe:Drosophila_2:1629144_at:325:195; Interrogation_Position=1024; Antisense; AACTGAACCGAGAGGCCATTGATGC
>probe:Drosophila_2:1629144_at:8:319; Interrogation_Position=1054; Antisense; GCCGTCTGTACGATGCTCTGGAGAG
>probe:Drosophila_2:1629144_at:447:425; Interrogation_Position=1074; Antisense; GAGAGCTCTAAGTGGCTGCCCATTG
>probe:Drosophila_2:1629144_at:580:625; Interrogation_Position=1090; Antisense; TGCCCATTGAGCAGCTGGAAGTCTT
>probe:Drosophila_2:1629144_at:142:167; Interrogation_Position=1182; Antisense; AAAGCCTGACTTGTAGCGTATTATT
>probe:Drosophila_2:1629144_at:398:291; Interrogation_Position=1198; Antisense; CGTATTATTGTTTTTGAGCCTGCTA
>probe:Drosophila_2:1629144_at:53:57; Interrogation_Position=711; Antisense; ATGACTGCAGCAGGTGGCACCGACT
>probe:Drosophila_2:1629144_at:284:521; Interrogation_Position=724; Antisense; GTGGCACCGACTACTCGCAGTACTA
>probe:Drosophila_2:1629144_at:570:309; Interrogation_Position=754; Antisense; CCACCAGCACCTATTGGCAGGGATA
>probe:Drosophila_2:1629144_at:277:445; Interrogation_Position=775; Antisense; GATACCAGGCCTGGCAAGGTTACTA
>probe:Drosophila_2:1629144_at:99:215; Interrogation_Position=790; Antisense; AAGGTTACTACGAGCAGGCCGGTGC
>probe:Drosophila_2:1629144_at:291:69; Interrogation_Position=805; Antisense; AGGCCGGTGCTTCGATCACAGATGC
>probe:Drosophila_2:1629144_at:389:253; Interrogation_Position=821; Antisense; CACAGATGCGGCTGCATACTACCAG
>probe:Drosophila_2:1629144_at:642:111; Interrogation_Position=997; Antisense; AGCACAAGTTCGTCCTGGATGTGGA

Paste this into a BLAST search page for me
AACTGAACCGAGAGGCCATTGATGCGCCGTCTGTACGATGCTCTGGAGAGGAGAGCTCTAAGTGGCTGCCCATTGTGCCCATTGAGCAGCTGGAAGTCTTAAAGCCTGACTTGTAGCGTATTATTCGTATTATTGTTTTTGAGCCTGCTAATGACTGCAGCAGGTGGCACCGACTGTGGCACCGACTACTCGCAGTACTACCACCAGCACCTATTGGCAGGGATAGATACCAGGCCTGGCAAGGTTACTAAAGGTTACTACGAGCAGGCCGGTGCAGGCCGGTGCTTCGATCACAGATGCCACAGATGCGGCTGCATACTACCAGAGCACAAGTTCGTCCTGGATGTGGA

Full Affymetrix probeset data:

Annotations for 1629144_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720