Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629145_at:

>probe:Drosophila_2:1629145_at:646:365; Interrogation_Position=15221; Antisense; GAATCTCCCAGCAGTTTACGGTCCA
>probe:Drosophila_2:1629145_at:412:697; Interrogation_Position=15235; Antisense; TTTACGGTCCACACCCACTAGGACA
>probe:Drosophila_2:1629145_at:198:679; Interrogation_Position=15253; Antisense; TAGGACACACGCAGCCTTCAAGTTA
>probe:Drosophila_2:1629145_at:41:17; Interrogation_Position=15268; Antisense; CTTCAAGTTAAACCCACTCACGCGA
>probe:Drosophila_2:1629145_at:673:145; Interrogation_Position=15283; Antisense; ACTCACGCGACACGTACACATATAT
>probe:Drosophila_2:1629145_at:559:705; Interrogation_Position=15327; Antisense; TTAAATTAGCACTTGAATCGGAGCA
>probe:Drosophila_2:1629145_at:567:421; Interrogation_Position=15347; Antisense; GAGCAAGACGACGAATCGAGCGAGA
>probe:Drosophila_2:1629145_at:433:367; Interrogation_Position=15457; Antisense; GAATCGGTCGATCGCATAATGAAAC
>probe:Drosophila_2:1629145_at:482:167; Interrogation_Position=15544; Antisense; AAATGTTAGTTGAAGTCCACTCATA
>probe:Drosophila_2:1629145_at:716:155; Interrogation_Position=15574; Antisense; ACACAAGGCTTAAACGTTAGACGCA
>probe:Drosophila_2:1629145_at:33:195; Interrogation_Position=15586; Antisense; AACGTTAGACGCAACCCAATTGAAT
>probe:Drosophila_2:1629145_at:116:725; Interrogation_Position=15678; Antisense; TTGATATTGATAACCCCGAGAACAC
>probe:Drosophila_2:1629145_at:573:447; Interrogation_Position=15747; Antisense; GATGCCGCAAAGAAAACTCTATCTG
>probe:Drosophila_2:1629145_at:117:193; Interrogation_Position=15761; Antisense; AACTCTATCTGAACTAAACGGAAGC

Paste this into a BLAST search page for me
GAATCTCCCAGCAGTTTACGGTCCATTTACGGTCCACACCCACTAGGACATAGGACACACGCAGCCTTCAAGTTACTTCAAGTTAAACCCACTCACGCGAACTCACGCGACACGTACACATATATTTAAATTAGCACTTGAATCGGAGCAGAGCAAGACGACGAATCGAGCGAGAGAATCGGTCGATCGCATAATGAAACAAATGTTAGTTGAAGTCCACTCATAACACAAGGCTTAAACGTTAGACGCAAACGTTAGACGCAACCCAATTGAATTTGATATTGATAACCCCGAGAACACGATGCCGCAAAGAAAACTCTATCTGAACTCTATCTGAACTAAACGGAAGC

Full Affymetrix probeset data:

Annotations for 1629145_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime