Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629147_at:

>probe:Drosophila_2:1629147_at:644:543; Interrogation_Position=1640; Antisense; GGATCTTATTCTACTCAAGGACGTA
>probe:Drosophila_2:1629147_at:224:409; Interrogation_Position=1659; Antisense; GACGTAGGTATTCTCACTGATGGAC
>probe:Drosophila_2:1629147_at:367:485; Interrogation_Position=1715; Antisense; GTATGTTCTTACCTATTCCATGTCC
>probe:Drosophila_2:1629147_at:101:231; Interrogation_Position=1742; Antisense; AATGACCGATAGTGTGCCTACCGTT
>probe:Drosophila_2:1629147_at:66:673; Interrogation_Position=1760; Antisense; TACCGTTTCGCGACAAACTCAGACG
>probe:Drosophila_2:1629147_at:209:409; Interrogation_Position=1781; Antisense; GACGCTACTGCCGAAGGCCTATAAC
>probe:Drosophila_2:1629147_at:144:225; Interrogation_Position=1806; Antisense; AAGGACCTGGTCAACTCCTATCTAC
>probe:Drosophila_2:1629147_at:183:631; Interrogation_Position=1821; Antisense; TCCTATCTACCCAAATCCGATGAGG
>probe:Drosophila_2:1629147_at:576:163; Interrogation_Position=1946; Antisense; AAATAGATTGGTACGCCCTGCTGCA
>probe:Drosophila_2:1629147_at:76:351; Interrogation_Position=1968; Antisense; GCAGTCCATCGATGACCTGATCAAA
>probe:Drosophila_2:1629147_at:390:365; Interrogation_Position=2037; Antisense; GAATCAAGCGCATCGCAGGTCGGTT
>probe:Drosophila_2:1629147_at:681:413; Interrogation_Position=2097; Antisense; GACCAAGTTTATAGCCCCATCGGAG
>probe:Drosophila_2:1629147_at:682:541; Interrogation_Position=2126; Antisense; GGTTGCCCCTCATTGAACAGCAGGA
>probe:Drosophila_2:1629147_at:231:571; Interrogation_Position=2184; Antisense; GGCTAAGAATGCCTCCCCAGAATAG

Paste this into a BLAST search page for me
GGATCTTATTCTACTCAAGGACGTAGACGTAGGTATTCTCACTGATGGACGTATGTTCTTACCTATTCCATGTCCAATGACCGATAGTGTGCCTACCGTTTACCGTTTCGCGACAAACTCAGACGGACGCTACTGCCGAAGGCCTATAACAAGGACCTGGTCAACTCCTATCTACTCCTATCTACCCAAATCCGATGAGGAAATAGATTGGTACGCCCTGCTGCAGCAGTCCATCGATGACCTGATCAAAGAATCAAGCGCATCGCAGGTCGGTTGACCAAGTTTATAGCCCCATCGGAGGGTTGCCCCTCATTGAACAGCAGGAGGCTAAGAATGCCTCCCCAGAATAG

Full Affymetrix probeset data:

Annotations for 1629147_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime