Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629149_at:

>probe:Drosophila_2:1629149_at:553:389; Interrogation_Position=1015; Antisense; GAAACCAGATGTCTTTGGGATCGCT
>probe:Drosophila_2:1629149_at:185:729; Interrogation_Position=1029; Antisense; TTGGGATCGCTATATGCAGGTCATA
>probe:Drosophila_2:1629149_at:648:625; Interrogation_Position=547; Antisense; TGCCTGCGTTTCGAAACCACCAAAA
>probe:Drosophila_2:1629149_at:648:169; Interrogation_Position=573; Antisense; AAAGTTGCAATACCTGAGCTTCAGT
>probe:Drosophila_2:1629149_at:445:85; Interrogation_Position=595; Antisense; AGTGATTTGTTGACCTGCTCCCATG
>probe:Drosophila_2:1629149_at:470:49; Interrogation_Position=617; Antisense; ATGCCATCATGATCTACTGGACGTA
>probe:Drosophila_2:1629149_at:720:555; Interrogation_Position=635; Antisense; GGACGTATACTTACCAGCACACTGG
>probe:Drosophila_2:1629149_at:403:263; Interrogation_Position=649; Antisense; CAGCACACTGGACCGGAGTACTATG
>probe:Drosophila_2:1629149_at:446:171; Interrogation_Position=688; Antisense; AAAGAGTTTCTCTTGGACCTGCGGG
>probe:Drosophila_2:1629149_at:106:77; Interrogation_Position=740; Antisense; AGGAGATTAAGCACCTCGTCTGCAT
>probe:Drosophila_2:1629149_at:294:123; Interrogation_Position=788; Antisense; AGCGCGCCTTTCACGAACTGGATGG
>probe:Drosophila_2:1629149_at:314:439; Interrogation_Position=808; Antisense; GATGGCAACTTTCGTTCTTACTGGC
>probe:Drosophila_2:1629149_at:331:453; Interrogation_Position=883; Antisense; GATCTTTTCGTCGATCTCTGTGAGA
>probe:Drosophila_2:1629149_at:247:377; Interrogation_Position=906; Antisense; GAAGCTTATTGATCCTTGGCGTCAG

Paste this into a BLAST search page for me
GAAACCAGATGTCTTTGGGATCGCTTTGGGATCGCTATATGCAGGTCATATGCCTGCGTTTCGAAACCACCAAAAAAAGTTGCAATACCTGAGCTTCAGTAGTGATTTGTTGACCTGCTCCCATGATGCCATCATGATCTACTGGACGTAGGACGTATACTTACCAGCACACTGGCAGCACACTGGACCGGAGTACTATGAAAGAGTTTCTCTTGGACCTGCGGGAGGAGATTAAGCACCTCGTCTGCATAGCGCGCCTTTCACGAACTGGATGGGATGGCAACTTTCGTTCTTACTGGCGATCTTTTCGTCGATCTCTGTGAGAGAAGCTTATTGATCCTTGGCGTCAG

Full Affymetrix probeset data:

Annotations for 1629149_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime