FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629150_at:

>probe:Drosophila_2:1629150_at:546:509; Interrogation_Position=1106; Antisense; GTGCATTTTATGAGCCAGGCGCAAA
>probe:Drosophila_2:1629150_at:653:69; Interrogation_Position=1122; Antisense; AGGCGCAAAAACTGTCATTCCGAAG
>probe:Drosophila_2:1629150_at:87:591; Interrogation_Position=1155; Antisense; TGGTAAGTTCTCTATTCGCCTTGTC
>probe:Drosophila_2:1629150_at:484:229; Interrogation_Position=1235; Antisense; AATGGGCCGAGCGAGGATCTCCTAA
>probe:Drosophila_2:1629150_at:311:79; Interrogation_Position=1268; Antisense; AGGTTACAATGCTCTCAGCTGGCAA
>probe:Drosophila_2:1629150_at:219:361; Interrogation_Position=1289; Antisense; GCAAGCCCTGGACTGAGGACCCTAA
>probe:Drosophila_2:1629150_at:567:403; Interrogation_Position=1306; Antisense; GACCCTAACCATCCTCATTATGAGG
>probe:Drosophila_2:1629150_at:16:521; Interrogation_Position=1363; Antisense; GTGGAACCAGATATGACCCGCGAAG
>probe:Drosophila_2:1629150_at:595:433; Interrogation_Position=1389; Antisense; GGGATCTATTCCAGTAACGTTAACA
>probe:Drosophila_2:1629150_at:663:175; Interrogation_Position=1434; Antisense; AAACGTTATCCTTGTGCCAGTGGGT
>probe:Drosophila_2:1629150_at:57:533; Interrogation_Position=1456; Antisense; GGTGCATGTGACGACGGTGCCCATT
>probe:Drosophila_2:1629150_at:384:73; Interrogation_Position=1518; Antisense; AGGCACTAAACTTCTTGGCGCCTAT
>probe:Drosophila_2:1629150_at:154:583; Interrogation_Position=1533; Antisense; TGGCGCCTATCTGCACGAAGTGGGA
>probe:Drosophila_2:1629150_at:617:425; Interrogation_Position=1640; Antisense; GAGAGACTCCTGTACATTGTTTAGT

Paste this into a BLAST search page for me
GTGCATTTTATGAGCCAGGCGCAAAAGGCGCAAAAACTGTCATTCCGAAGTGGTAAGTTCTCTATTCGCCTTGTCAATGGGCCGAGCGAGGATCTCCTAAAGGTTACAATGCTCTCAGCTGGCAAGCAAGCCCTGGACTGAGGACCCTAAGACCCTAACCATCCTCATTATGAGGGTGGAACCAGATATGACCCGCGAAGGGGATCTATTCCAGTAACGTTAACAAAACGTTATCCTTGTGCCAGTGGGTGGTGCATGTGACGACGGTGCCCATTAGGCACTAAACTTCTTGGCGCCTATTGGCGCCTATCTGCACGAAGTGGGAGAGAGACTCCTGTACATTGTTTAGT

Full Affymetrix probeset data:

Annotations for 1629150_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720