Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629151_at:

>probe:Drosophila_2:1629151_at:365:651; Interrogation_Position=1015; Antisense; TCAAAGCAGATGCAGCCGACGCAAT
>probe:Drosophila_2:1629151_at:125:229; Interrogation_Position=1037; Antisense; AATGGAGAAGACCTGCCCTATGTGC
>probe:Drosophila_2:1629151_at:239:209; Interrogation_Position=1065; Antisense; AAGCAGTACTCCAGCCAAGTGTCCT
>probe:Drosophila_2:1629151_at:482:221; Interrogation_Position=1081; Antisense; AAGTGTCCTTCAATGCGTTCCGCGA
>probe:Drosophila_2:1629151_at:422:325; Interrogation_Position=1102; Antisense; GCGAGCACGTCGAGATGCACTTCAT
>probe:Drosophila_2:1629151_at:710:43; Interrogation_Position=1125; Antisense; ATCGACGATGCACTGGAACTGGAGT
>probe:Drosophila_2:1629151_at:515:607; Interrogation_Position=1163; Antisense; TGAGCGCCAGTTTGAGTTCGTTTCC
>probe:Drosophila_2:1629151_at:404:719; Interrogation_Position=1184; Antisense; TTCCCATGCTGTGGGTGACTTCTGA
>probe:Drosophila_2:1629151_at:689:611; Interrogation_Position=1199; Antisense; TGACTTCTGACCCAGTAGGCGCATT
>probe:Drosophila_2:1629151_at:255:679; Interrogation_Position=1214; Antisense; TAGGCGCATTTATTTCGCCACCGAA
>probe:Drosophila_2:1629151_at:491:293; Interrogation_Position=1235; Antisense; CGAACTCTGACCTGACCGGAGAAAT
>probe:Drosophila_2:1629151_at:490:113; Interrogation_Position=1273; Antisense; AGCAGTTTGACTGCGCAGGAGCCGC
>probe:Drosophila_2:1629151_at:49:417; Interrogation_Position=1291; Antisense; GAGCCGCTTGTTACGTTTCTATTGA
>probe:Drosophila_2:1629151_at:143:105; Interrogation_Position=1318; Antisense; AGACGTTAGGGCGATCATGTATCAA

Paste this into a BLAST search page for me
TCAAAGCAGATGCAGCCGACGCAATAATGGAGAAGACCTGCCCTATGTGCAAGCAGTACTCCAGCCAAGTGTCCTAAGTGTCCTTCAATGCGTTCCGCGAGCGAGCACGTCGAGATGCACTTCATATCGACGATGCACTGGAACTGGAGTTGAGCGCCAGTTTGAGTTCGTTTCCTTCCCATGCTGTGGGTGACTTCTGATGACTTCTGACCCAGTAGGCGCATTTAGGCGCATTTATTTCGCCACCGAACGAACTCTGACCTGACCGGAGAAATAGCAGTTTGACTGCGCAGGAGCCGCGAGCCGCTTGTTACGTTTCTATTGAAGACGTTAGGGCGATCATGTATCAA

Full Affymetrix probeset data:

Annotations for 1629151_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime