FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629154_at:

>probe:Drosophila_2:1629154_at:206:133; Interrogation_Position=1018; Antisense; ACCCTCCTGATCTTCTTGATGCAAA
>probe:Drosophila_2:1629154_at:19:447; Interrogation_Position=1035; Antisense; GATGCAAACACAACACCCGATGGAG
>probe:Drosophila_2:1629154_at:606:653; Interrogation_Position=1061; Antisense; TAAGAGTCGGCAACGTTTACCCCAT
>probe:Drosophila_2:1629154_at:211:403; Interrogation_Position=1086; Antisense; GACATTGGCCATGTTCCAGAGTCTG
>probe:Drosophila_2:1629154_at:306:309; Interrogation_Position=1101; Antisense; CCAGAGTCTGTTGAATGCGTCCTAC
>probe:Drosophila_2:1629154_at:296:667; Interrogation_Position=1129; Antisense; TACTTTACCATGCTGCGTGGCGTCA
>probe:Drosophila_2:1629154_at:612:581; Interrogation_Position=1146; Antisense; TGGCGTCACCGGCAAATGAGCTGAA
>probe:Drosophila_2:1629154_at:187:635; Interrogation_Position=1254; Antisense; TCGCTTTTCCAGCAATCCGGGTAAT
>probe:Drosophila_2:1629154_at:400:183; Interrogation_Position=1282; Antisense; AAAAGTTGTTGCTGGCTGTGGTCCT
>probe:Drosophila_2:1629154_at:113:461; Interrogation_Position=1348; Antisense; GATTTAATCGGACTGCTGGCACGGA
>probe:Drosophila_2:1629154_at:393:337; Interrogation_Position=1385; Antisense; GCTCCTGGATCCTGGCATGCAAATA
>probe:Drosophila_2:1629154_at:558:625; Interrogation_Position=1508; Antisense; TGCCCATTCTGTTTGCTCGGGATGC
>probe:Drosophila_2:1629154_at:237:283; Interrogation_Position=971; Antisense; CTGTTTACAATGTGCCCTGGTACGA
>probe:Drosophila_2:1629154_at:13:439; Interrogation_Position=994; Antisense; GAGGCAGGAACTCGGTTTCGCAAAA

Paste this into a BLAST search page for me
ACCCTCCTGATCTTCTTGATGCAAAGATGCAAACACAACACCCGATGGAGTAAGAGTCGGCAACGTTTACCCCATGACATTGGCCATGTTCCAGAGTCTGCCAGAGTCTGTTGAATGCGTCCTACTACTTTACCATGCTGCGTGGCGTCATGGCGTCACCGGCAAATGAGCTGAATCGCTTTTCCAGCAATCCGGGTAATAAAAGTTGTTGCTGGCTGTGGTCCTGATTTAATCGGACTGCTGGCACGGAGCTCCTGGATCCTGGCATGCAAATATGCCCATTCTGTTTGCTCGGGATGCCTGTTTACAATGTGCCCTGGTACGAGAGGCAGGAACTCGGTTTCGCAAAA

Full Affymetrix probeset data:

Annotations for 1629154_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720