FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629155_at:

>probe:Drosophila_2:1629155_at:98:587; Interrogation_Position=409; Antisense; TGGACGTGGACATCCTGATCACGGG
>probe:Drosophila_2:1629155_at:67:357; Interrogation_Position=434; Antisense; GCACACGTACAAGTTCGAGGCCTAC
>probe:Drosophila_2:1629155_at:109:439; Interrogation_Position=450; Antisense; GAGGCCTACGAGCACGGCAACAAAT
>probe:Drosophila_2:1629155_at:336:245; Interrogation_Position=472; Antisense; AATTCTACATCAATCCGGGATCGGC
>probe:Drosophila_2:1629155_at:20:587; Interrogation_Position=517; Antisense; TGGACACCAATGTGGTGCCTTCGTT
>probe:Drosophila_2:1629155_at:313:315; Interrogation_Position=533; Antisense; GCCTTCGTTCGTGCTGATGGACATT
>probe:Drosophila_2:1629155_at:631:585; Interrogation_Position=550; Antisense; TGGACATTCAGAGCACCACGGTGGT
>probe:Drosophila_2:1629155_at:394:257; Interrogation_Position=566; Antisense; CACGGTGGTCACGTACGTGTACCAA
>probe:Drosophila_2:1629155_at:340:513; Interrogation_Position=582; Antisense; GTGTACCAACTGATCGGCGACGAGG
>probe:Drosophila_2:1629155_at:263:171; Interrogation_Position=609; Antisense; AAAGTGGAGCGCATCGAGTACAAGA
>probe:Drosophila_2:1629155_at:211:653; Interrogation_Position=639; Antisense; TAGGGTCCTAGTATTAGCCACCAGC
>probe:Drosophila_2:1629155_at:232:345; Interrogation_Position=694; Antisense; GCATTCTGAGCTCGGCTTCATTAAA
>probe:Drosophila_2:1629155_at:302:185; Interrogation_Position=773; Antisense; AAAATGCTAGCACCTTGTTTAAATA
>probe:Drosophila_2:1629155_at:430:513; Interrogation_Position=889; Antisense; GTGATACTCCCACAATAATCTGATA

Paste this into a BLAST search page for me
TGGACGTGGACATCCTGATCACGGGGCACACGTACAAGTTCGAGGCCTACGAGGCCTACGAGCACGGCAACAAATAATTCTACATCAATCCGGGATCGGCTGGACACCAATGTGGTGCCTTCGTTGCCTTCGTTCGTGCTGATGGACATTTGGACATTCAGAGCACCACGGTGGTCACGGTGGTCACGTACGTGTACCAAGTGTACCAACTGATCGGCGACGAGGAAAGTGGAGCGCATCGAGTACAAGATAGGGTCCTAGTATTAGCCACCAGCGCATTCTGAGCTCGGCTTCATTAAAAAAATGCTAGCACCTTGTTTAAATAGTGATACTCCCACAATAATCTGATA

Full Affymetrix probeset data:

Annotations for 1629155_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720