Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629156_at:

>probe:Drosophila_2:1629156_at:201:511; Interrogation_Position=2450; Antisense; GTGAAAGATGCAAGATTCATCCAAA
>probe:Drosophila_2:1629156_at:282:121; Interrogation_Position=2638; Antisense; AGCGGCAAGAACTCCCTAAAAATAG
>probe:Drosophila_2:1629156_at:438:181; Interrogation_Position=2747; Antisense; AAAACCAGAAGAACCATTTCAGATT
>probe:Drosophila_2:1629156_at:134:381; Interrogation_Position=2757; Antisense; GAACCATTTCAGATTTGTATGCAAA
>probe:Drosophila_2:1629156_at:108:483; Interrogation_Position=2785; Antisense; GTATATGTACGTACTTTCCTTTAAT
>probe:Drosophila_2:1629156_at:271:275; Interrogation_Position=2798; Antisense; CTTTCCTTTAATTTTAGCCAATCAG
>probe:Drosophila_2:1629156_at:558:243; Interrogation_Position=2807; Antisense; AATTTTAGCCAATCAGTTTGTAAGA
>probe:Drosophila_2:1629156_at:272:491; Interrogation_Position=2907; Antisense; GTAACCGTTAGAATTAGCCCATAAT
>probe:Drosophila_2:1629156_at:710:673; Interrogation_Position=2921; Antisense; TAGCCCATAATGGTCGATATCTAAA
>probe:Drosophila_2:1629156_at:515:65; Interrogation_Position=2930; Antisense; ATGGTCGATATCTAAATGTGTGTGT
>probe:Drosophila_2:1629156_at:79:229; Interrogation_Position=2944; Antisense; AATGTGTGTGTATATCGATGTGATG
>probe:Drosophila_2:1629156_at:659:441; Interrogation_Position=2960; Antisense; GATGTGATGTCATCGATTGTCGATA
>probe:Drosophila_2:1629156_at:450:637; Interrogation_Position=2972; Antisense; TCGATTGTCGATAACGATTGGATGC
>probe:Drosophila_2:1629156_at:316:661; Interrogation_Position=2983; Antisense; TAACGATTGGATGCGAGTGTGTGTT

Paste this into a BLAST search page for me
GTGAAAGATGCAAGATTCATCCAAAAGCGGCAAGAACTCCCTAAAAATAGAAAACCAGAAGAACCATTTCAGATTGAACCATTTCAGATTTGTATGCAAAGTATATGTACGTACTTTCCTTTAATCTTTCCTTTAATTTTAGCCAATCAGAATTTTAGCCAATCAGTTTGTAAGAGTAACCGTTAGAATTAGCCCATAATTAGCCCATAATGGTCGATATCTAAAATGGTCGATATCTAAATGTGTGTGTAATGTGTGTGTATATCGATGTGATGGATGTGATGTCATCGATTGTCGATATCGATTGTCGATAACGATTGGATGCTAACGATTGGATGCGAGTGTGTGTT

Full Affymetrix probeset data:

Annotations for 1629156_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime