FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629158_at:

>probe:Drosophila_2:1629158_at:590:237; Interrogation_Position=324; Antisense; AATCTGCGGCAAGTGGTGCGTTTGC
>probe:Drosophila_2:1629158_at:314:367; Interrogation_Position=359; Antisense; GAATCTCAACGACTGGCTAGCTGTG
>probe:Drosophila_2:1629158_at:66:675; Interrogation_Position=376; Antisense; TAGCTGTGCACGTTGTGGACTTCTT
>probe:Drosophila_2:1629158_at:698:519; Interrogation_Position=390; Antisense; GTGGACTTCTTCAATCGCATAAACT
>probe:Drosophila_2:1629158_at:612:343; Interrogation_Position=406; Antisense; GCATAAACTTGATCTACGGCACCGT
>probe:Drosophila_2:1629158_at:258:671; Interrogation_Position=420; Antisense; TACGGCACCGTTTCGGAGTTTTGCA
>probe:Drosophila_2:1629158_at:621:359; Interrogation_Position=442; Antisense; GCAACGAAACTACGTGTCCCACGAT
>probe:Drosophila_2:1629158_at:619:573; Interrogation_Position=471; Antisense; GGCGGTTCCAGATATGAGTACTTAT
>probe:Drosophila_2:1629158_at:516:207; Interrogation_Position=592; Antisense; AAGCTGTTTTTCCAGTGTCCACGGA
>probe:Drosophila_2:1629158_at:679:309; Interrogation_Position=610; Antisense; CCACGGATGTTCCATTTCCCAAGAA
>probe:Drosophila_2:1629158_at:490:513; Interrogation_Position=676; Antisense; GTGTTTTCGTCCACGTCTATATTCA
>probe:Drosophila_2:1629158_at:547:21; Interrogation_Position=694; Antisense; ATATTCACCATTTCGATCGGATTGT
>probe:Drosophila_2:1629158_at:730:377; Interrogation_Position=732; Antisense; GAAGCTCACGTGAATGCCTGCTACA
>probe:Drosophila_2:1629158_at:255:365; Interrogation_Position=780; Antisense; GAATTTGACATGATTTCGGCCAAGG

Paste this into a BLAST search page for me
AATCTGCGGCAAGTGGTGCGTTTGCGAATCTCAACGACTGGCTAGCTGTGTAGCTGTGCACGTTGTGGACTTCTTGTGGACTTCTTCAATCGCATAAACTGCATAAACTTGATCTACGGCACCGTTACGGCACCGTTTCGGAGTTTTGCAGCAACGAAACTACGTGTCCCACGATGGCGGTTCCAGATATGAGTACTTATAAGCTGTTTTTCCAGTGTCCACGGACCACGGATGTTCCATTTCCCAAGAAGTGTTTTCGTCCACGTCTATATTCAATATTCACCATTTCGATCGGATTGTGAAGCTCACGTGAATGCCTGCTACAGAATTTGACATGATTTCGGCCAAGG

Full Affymetrix probeset data:

Annotations for 1629158_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720