FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629159_at:

>probe:Drosophila_2:1629159_at:575:235; Interrogation_Position=339; Antisense; AATCCCACACCGAGGATGGTCTACA
>probe:Drosophila_2:1629159_at:201:209; Interrogation_Position=396; Antisense; AAGCAGTACCGCTACAAGTGCCGAA
>probe:Drosophila_2:1629159_at:210:377; Interrogation_Position=418; Antisense; GAAGCTGCAGTCTGCCGCTTTACTA
>probe:Drosophila_2:1629159_at:435:137; Interrogation_Position=463; Antisense; ACGTAACCTTCGTCATGTCCAATGC
>probe:Drosophila_2:1629159_at:252:629; Interrogation_Position=493; Antisense; TCCGCAACAAGGGTGAGAGTCCTCT
>probe:Drosophila_2:1629159_at:140:159; Interrogation_Position=519; Antisense; ACACAGCTGCTGAATTCGGAGATCA
>probe:Drosophila_2:1629159_at:593:249; Interrogation_Position=542; Antisense; CAAGGGCAGTTTCAAGGCACCGGCT
>probe:Drosophila_2:1629159_at:78:317; Interrogation_Position=585; Antisense; GCCGGTCCAGACGATTCGGGTATTG
>probe:Drosophila_2:1629159_at:16:111; Interrogation_Position=625; Antisense; AGAAGGTCGTCGTCACCAGACACAC
>probe:Drosophila_2:1629159_at:523:151; Interrogation_Position=655; Antisense; ACATGGGCAAGTTCAGCTCGGTCAC
>probe:Drosophila_2:1629159_at:653:645; Interrogation_Position=676; Antisense; TCACGGTGTCTACCATCGACGAGGA
>probe:Drosophila_2:1629159_at:595:43; Interrogation_Position=711; Antisense; ATCGAGGCGCGCGAGATCGCAGACA
>probe:Drosophila_2:1629159_at:670:123; Interrogation_Position=850; Antisense; AGCGCGGCACGCTACTGGAAAGATA
>probe:Drosophila_2:1629159_at:652:559; Interrogation_Position=866; Antisense; GGAAAGATAGTCACACTCTGCCTCC

Paste this into a BLAST search page for me
AATCCCACACCGAGGATGGTCTACAAAGCAGTACCGCTACAAGTGCCGAAGAAGCTGCAGTCTGCCGCTTTACTAACGTAACCTTCGTCATGTCCAATGCTCCGCAACAAGGGTGAGAGTCCTCTACACAGCTGCTGAATTCGGAGATCACAAGGGCAGTTTCAAGGCACCGGCTGCCGGTCCAGACGATTCGGGTATTGAGAAGGTCGTCGTCACCAGACACACACATGGGCAAGTTCAGCTCGGTCACTCACGGTGTCTACCATCGACGAGGAATCGAGGCGCGCGAGATCGCAGACAAGCGCGGCACGCTACTGGAAAGATAGGAAAGATAGTCACACTCTGCCTCC

Full Affymetrix probeset data:

Annotations for 1629159_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720