FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629161_at:

>probe:Drosophila_2:1629161_at:413:243; Interrogation_Position=140; Antisense; AATTTGATGCTAAAGAAGACTCTCT
>probe:Drosophila_2:1629161_at:571:375; Interrogation_Position=154; Antisense; GAAGACTCTCTTCAAAGCAAGTGTT
>probe:Drosophila_2:1629161_at:219:171; Interrogation_Position=16; Antisense; AAAGTATTCCTGTTGTTCATTTTCA
>probe:Drosophila_2:1629161_at:163:599; Interrogation_Position=175; Antisense; TGTTTTTATCACTGCTTACTGGAAG
>probe:Drosophila_2:1629161_at:729:5; Interrogation_Position=211; Antisense; ATTGCAAATGATGCGATCAGTTCGG
>probe:Drosophila_2:1629161_at:542:451; Interrogation_Position=225; Antisense; GATCAGTTCGGAGCAACCGAGGAAA
>probe:Drosophila_2:1629161_at:347:215; Interrogation_Position=262; Antisense; AAGTATGGCATTACTGACACAGATG
>probe:Drosophila_2:1629161_at:540:83; Interrogation_Position=308; Antisense; AGTGTCATTCCATCAAGGCTTCAGG
>probe:Drosophila_2:1629161_at:577:711; Interrogation_Position=31; Antisense; TTCATTTTCATCTCTGCTATCTGGC
>probe:Drosophila_2:1629161_at:238:511; Interrogation_Position=338; Antisense; GTGAATTGGGCTACGAAATCTTGAA
>probe:Drosophila_2:1629161_at:273:165; Interrogation_Position=353; Antisense; AAATCTTGAAATGCTATCAGTCCAT
>probe:Drosophila_2:1629161_at:159:341; Interrogation_Position=46; Antisense; GCTATCTGGCTCCAAGCATTTTGTA
>probe:Drosophila_2:1629161_at:340:345; Interrogation_Position=61; Antisense; GCATTTTGTATGAAATCTTCTGAAA
>probe:Drosophila_2:1629161_at:386:175; Interrogation_Position=91; Antisense; AAAGCCTGCTTGAAACGGCAGCTGG

Paste this into a BLAST search page for me
AATTTGATGCTAAAGAAGACTCTCTGAAGACTCTCTTCAAAGCAAGTGTTAAAGTATTCCTGTTGTTCATTTTCATGTTTTTATCACTGCTTACTGGAAGATTGCAAATGATGCGATCAGTTCGGGATCAGTTCGGAGCAACCGAGGAAAAAGTATGGCATTACTGACACAGATGAGTGTCATTCCATCAAGGCTTCAGGTTCATTTTCATCTCTGCTATCTGGCGTGAATTGGGCTACGAAATCTTGAAAAATCTTGAAATGCTATCAGTCCATGCTATCTGGCTCCAAGCATTTTGTAGCATTTTGTATGAAATCTTCTGAAAAAAGCCTGCTTGAAACGGCAGCTGG

Full Affymetrix probeset data:

Annotations for 1629161_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720