FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629162_at:

>probe:Drosophila_2:1629162_at:614:125; Interrogation_Position=1000; Antisense; AGCCTCTACTTGTTCTTCATCATTA
>probe:Drosophila_2:1629162_at:47:657; Interrogation_Position=1043; Antisense; TAATGTCGCAACTCTCCGAGGGATT
>probe:Drosophila_2:1629162_at:176:679; Interrogation_Position=1082; Antisense; TAGGACTGACTATCACGGCTTTGTG
>probe:Drosophila_2:1629162_at:203:557; Interrogation_Position=1114; Antisense; GGACTGCTCTTCTATATTTGCGATG
>probe:Drosophila_2:1629162_at:556:13; Interrogation_Position=1145; Antisense; ATTATGCCTCGGTTAATGTGCGAAC
>probe:Drosophila_2:1629162_at:590:545; Interrogation_Position=1208; Antisense; GGATGAACTCGGATGCCCAGACGGA
>probe:Drosophila_2:1629162_at:260:23; Interrogation_Position=1238; Antisense; ATATGTTTTTGCGAGCCACCGAAAT
>probe:Drosophila_2:1629162_at:18:233; Interrogation_Position=1260; Antisense; AATGAATCCATCGACCATCAACTGC
>probe:Drosophila_2:1629162_at:32:285; Interrogation_Position=1281; Antisense; CTGCGGTGGCTTTTTTGATGTGAAC
>probe:Drosophila_2:1629162_at:677:91; Interrogation_Position=1364; Antisense; AGTTTCAGATCAGTATCCCCACAGA
>probe:Drosophila_2:1629162_at:416:655; Interrogation_Position=1466; Antisense; TAATGGGAGCCAGCACTCTGAGCAC
>probe:Drosophila_2:1629162_at:193:695; Interrogation_Position=1509; Antisense; TTTGCCACCGCCAATTATGAAGCTA
>probe:Drosophila_2:1629162_at:21:457; Interrogation_Position=961; Antisense; GATACTGGAAATGCCCTGTGCTACA
>probe:Drosophila_2:1629162_at:46:157; Interrogation_Position=983; Antisense; ACACCTTTGTTTTCATGAGCCTCTA

Paste this into a BLAST search page for me
AGCCTCTACTTGTTCTTCATCATTATAATGTCGCAACTCTCCGAGGGATTTAGGACTGACTATCACGGCTTTGTGGGACTGCTCTTCTATATTTGCGATGATTATGCCTCGGTTAATGTGCGAACGGATGAACTCGGATGCCCAGACGGAATATGTTTTTGCGAGCCACCGAAATAATGAATCCATCGACCATCAACTGCCTGCGGTGGCTTTTTTGATGTGAACAGTTTCAGATCAGTATCCCCACAGATAATGGGAGCCAGCACTCTGAGCACTTTGCCACCGCCAATTATGAAGCTAGATACTGGAAATGCCCTGTGCTACAACACCTTTGTTTTCATGAGCCTCTA

Full Affymetrix probeset data:

Annotations for 1629162_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720