FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629163_at:

>probe:Drosophila_2:1629163_at:247:721; Interrogation_Position=1044; Antisense; TTGCGGTGACGCCTGAGAACTGAAA
>probe:Drosophila_2:1629163_at:182:421; Interrogation_Position=1130; Antisense; GAGCAGTGTCTTCGATTAAATTCAA
>probe:Drosophila_2:1629163_at:292:435; Interrogation_Position=602; Antisense; GAGGTGCTCATCTTCAGTCAGACAA
>probe:Drosophila_2:1629163_at:192:445; Interrogation_Position=638; Antisense; GATGAGCTGTCCGTTGACTTGCCAT
>probe:Drosophila_2:1629163_at:427:39; Interrogation_Position=661; Antisense; ATCTCCTGGCAAATCTGAGCCGGAA
>probe:Drosophila_2:1629163_at:155:503; Interrogation_Position=703; Antisense; GTCCCAATCTCAGTTCAATCTGGAA
>probe:Drosophila_2:1629163_at:443:39; Interrogation_Position=727; Antisense; ATCTGAACAGCAACCTCAACCGGAA
>probe:Drosophila_2:1629163_at:109:131; Interrogation_Position=745; Antisense; ACCGGAAACCAACAGCACAGACATT
>probe:Drosophila_2:1629163_at:664:153; Interrogation_Position=790; Antisense; ACAGATCGCTGAATTGTCGGCATCA
>probe:Drosophila_2:1629163_at:296:345; Interrogation_Position=809; Antisense; GCATCAGTGATGTCGTCCAAAGTAA
>probe:Drosophila_2:1629163_at:464:171; Interrogation_Position=827; Antisense; AAAGTAATGCTCGATGCGCCGCACA
>probe:Drosophila_2:1629163_at:391:261; Interrogation_Position=881; Antisense; CAGCTGGGCAGCACGGTATCGGCAC
>probe:Drosophila_2:1629163_at:188:573; Interrogation_Position=918; Antisense; GGCGGAACATCGACATCGCTGAGTC
>probe:Drosophila_2:1629163_at:723:349; Interrogation_Position=952; Antisense; GCAGACTCGACGATTGCGCGAACAG

Paste this into a BLAST search page for me
TTGCGGTGACGCCTGAGAACTGAAAGAGCAGTGTCTTCGATTAAATTCAAGAGGTGCTCATCTTCAGTCAGACAAGATGAGCTGTCCGTTGACTTGCCATATCTCCTGGCAAATCTGAGCCGGAAGTCCCAATCTCAGTTCAATCTGGAAATCTGAACAGCAACCTCAACCGGAAACCGGAAACCAACAGCACAGACATTACAGATCGCTGAATTGTCGGCATCAGCATCAGTGATGTCGTCCAAAGTAAAAAGTAATGCTCGATGCGCCGCACACAGCTGGGCAGCACGGTATCGGCACGGCGGAACATCGACATCGCTGAGTCGCAGACTCGACGATTGCGCGAACAG

Full Affymetrix probeset data:

Annotations for 1629163_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720