FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629164_at:

>probe:Drosophila_2:1629164_at:356:125; Interrogation_Position=1006; Antisense; AGCCGATGTGCTCTTGGGCAAGAAC
>probe:Drosophila_2:1629164_at:620:209; Interrogation_Position=1025; Antisense; AAGAACTCGGTGTCCTTGACGATTT
>probe:Drosophila_2:1629164_at:264:107; Interrogation_Position=1052; Antisense; AGAAAGACCTACAACTCCATTGCCT
>probe:Drosophila_2:1629164_at:526:107; Interrogation_Position=1131; Antisense; AGAACTTCGCGATTGCTCTGATGAC
>probe:Drosophila_2:1629164_at:70:667; Interrogation_Position=1255; Antisense; TACAGCGGCGAATTTCGTGCCCATA
>probe:Drosophila_2:1629164_at:109:319; Interrogation_Position=1273; Antisense; GCCCATAGTCACTCCTTTAGTTGTT
>probe:Drosophila_2:1629164_at:443:73; Interrogation_Position=1311; Antisense; AGGAAAATTCTGATCGCTCCCAATG
>probe:Drosophila_2:1629164_at:496:337; Interrogation_Position=1326; Antisense; GCTCCCAATGGCAGATCGTGTTCAT
>probe:Drosophila_2:1629164_at:450:639; Interrogation_Position=1341; Antisense; TCGTGTTCATCATTGCCTCCGTAAT
>probe:Drosophila_2:1629164_at:191:307; Interrogation_Position=1356; Antisense; CCTCCGTAATCTTCTTTGTGGGCAA
>probe:Drosophila_2:1629164_at:441:703; Interrogation_Position=1387; Antisense; TTACTTGGTGTTTGGCACGGCCGAA
>probe:Drosophila_2:1629164_at:89:379; Interrogation_Position=1450; Antisense; GAACCCGGAACTTGCCAATAGACCA
>probe:Drosophila_2:1629164_at:402:241; Interrogation_Position=1466; Antisense; AATAGACCACCTATGCAGGCGTTAT
>probe:Drosophila_2:1629164_at:155:483; Interrogation_Position=988; Antisense; GTATATTTACCTAGTCGTAGCCGAT

Paste this into a BLAST search page for me
AGCCGATGTGCTCTTGGGCAAGAACAAGAACTCGGTGTCCTTGACGATTTAGAAAGACCTACAACTCCATTGCCTAGAACTTCGCGATTGCTCTGATGACTACAGCGGCGAATTTCGTGCCCATAGCCCATAGTCACTCCTTTAGTTGTTAGGAAAATTCTGATCGCTCCCAATGGCTCCCAATGGCAGATCGTGTTCATTCGTGTTCATCATTGCCTCCGTAATCCTCCGTAATCTTCTTTGTGGGCAATTACTTGGTGTTTGGCACGGCCGAAGAACCCGGAACTTGCCAATAGACCAAATAGACCACCTATGCAGGCGTTATGTATATTTACCTAGTCGTAGCCGAT

Full Affymetrix probeset data:

Annotations for 1629164_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720